LRRC68-leucine rich repeat containing 68 Gene View larger

LRRC68-leucine rich repeat containing 68 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRRC68-leucine rich repeat containing 68 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LRRC68-leucine rich repeat containing 68 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC039061
Product type: DNA & cDNA
Ncbi symbol: LRRC68
Origin species: Human
Product name: LRRC68-leucine rich repeat containing 68 Gene
Size: 2ug
Accessions: BC039061
Gene id: 284352
Gene description: leucine rich repeat containing 68
Synonyms: LRRC68; protein phosphatase 1 regulatory subunit 37; leucine rich repeat containing 68; leucine-rich repeat-containing protein 68
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgagaccaccgccaccgagccccagcccgacgacgagcccgccgctggggtgcagaacggggcccccagccccgcacccagcccggactcagactcagactcggactcggatggggaggaagaggaggaagaggaaggggagagggacgagaccccctgtcctgccctggtgccccccacggactccctgggccctggggacaggagtcccccaggcagcccctccacacccaccgagcagcggatttccgtgtccagcccgggccggggccacaaggtgtttgtggtgacccgggtggagagcccgcccgagagggcagagccccctgcgtcccccacccctccctctcccccaccccctccctccccacccgcctcaccttccctaccaccagccggggccattgacacccgggacacagggtcctctgagcctcagccaccaccggagccgcctcggtcagggccaccactgcccaacggcctgaagcccgagttcgccctggcactgccccctgagccgcccccggggcctgaggtcaaggggggcagctgcggcctggagcacgaactgagctgctccaagaacgagaaggagctcgaggagctgcttctggaagccagtcaggaatccgggcaggagacactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gap junction protein, beta 2, 26kDa
- chromosome 1 open reading frame 2
- cysteine-rich secretory protein 2
- leucine rich repeat containing 61

Buy LRRC68-leucine rich repeat containing 68 Gene now

Add to cart