C22orf23-chromosome 22 open reading frame 23 Gene View larger

C22orf23-chromosome 22 open reading frame 23 Gene

PTXBC031998

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C22orf23-chromosome 22 open reading frame 23 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C22orf23-chromosome 22 open reading frame 23 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031998
Product type: DNA & cDNA
Ncbi symbol: C22orf23
Origin species: Human
Product name: C22orf23-chromosome 22 open reading frame 23 Gene
Size: 2ug
Accessions: BC031998
Gene id: 84645
Gene description: chromosome 22 open reading frame 23
Synonyms: EVG1; dJ1039K5.6; UPF0193 protein EVG1; chromosome 22 open reading frame 23
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttcacagaagcagatggaggtagtgaccaaaggaactgggttccggcgccgccccaagaccatcacttacaccccggggacctgcgagctgctcagagtgatgatgaaggaatccaaactgacgaacatccagcagcgccacatcatggacatcatgaaaagaggagatgctttgcccctacagtgcagcccaacatccagccagagagtcttaccttccaagcaaatagcctcgcccatctacctgcctcccatcctcgcagcccgtccccacctccggcctgccaacatgtgtcaagccaatggggcctacagccgggagcagttcaagcctcaagccaccagggatttggagaaggagaaacaaagactccaaaatatctttgccacggggaaggacatggaggaacggaaaagaaaggcccctcctgcacgacagaaggctccagcccctgagctagaccgatttgaagagctggtgaaggaaatccaggagaggaaagaattcctggctgacatggaggccctgggacagggcaaacagtaccgaggaatcatccttgctgaaatctcccagaaactccgggaaatggaagacattgaccacagaaggagtgaggaacttaggaagggtcttgccaccacttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 16 open reading frame 79
- chromosome 1 open reading frame 216
- chromosome 6 open reading frame 142
- chromosome 20 open reading frame 74

Buy C22orf23-chromosome 22 open reading frame 23 Gene now

Add to cart