GAR1-GAR1 ribonucleoprotein homolog (yeast) Gene View larger

GAR1-GAR1 ribonucleoprotein homolog (yeast) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GAR1-GAR1 ribonucleoprotein homolog (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GAR1-GAR1 ribonucleoprotein homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003413
Product type: DNA & cDNA
Ncbi symbol: GAR1
Origin species: Human
Product name: GAR1-GAR1 ribonucleoprotein homolog (yeast) Gene
Size: 2ug
Accessions: BC003413
Gene id: 54433
Gene description: GAR1 ribonucleoprotein homolog (yeast)
Synonyms: GAR1 ribonucleoprotein; snoRNP protein GAR1; GAR1 ribonucleoprotein homolog; GAR1 homolog, ribonucleoprotein; NOLA1; H/ACA ribonucleoprotein complex subunit 1; nucleolar protein family A member 1; nucleolar protein family A, member 1 (H/ACA small nucleolar RNPs)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcttttcgaggcggaggtcgtggaggctttaatcgaggtggtggaggtggcggcttcaaccgaggcggcagcagcaaccacttccgaggtggaggcggcggtggaggcggcggcaatttcagaggcggcggcaggggaggatttggacgagggggtggccgcggaggctttaacaaaggccaagaccaaggacctccagaacgtgtagtcttattaggagagttcctgcatccctgtgaagatgacatagtttgtaaatgtaccacagatgaaaataaggtgccttatttcaatgctcctgtttacttagaaaacaaagaacaaattggaaaagtggatgaaatatttggacaactcagagatttttatttttcagttaagttgtcagaaaacatgaaggcttcatcctttaaaaaactacagaagttttatatagacccatataagctgctgccactgcagaggtttttacctcgacctccaggtgagaaaggacctccaagaggtggtggcaggggaggccgaggaggaggaagaggaggaggtggcagaggtggtggcagaggtggtggttttagaggtggaagaggaggtggaggtgggggcttcagaggaggaagaggtggtggtttcagagggagaggacattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Na+/H+ exchanger domain containing 1
- GINS complex subunit 4 (Sld5 homolog)
- secretory carrier membrane protein 4
- secretory carrier membrane protein 5

Buy GAR1-GAR1 ribonucleoprotein homolog (yeast) Gene now

Add to cart