RAN-RAN, member RAS oncogene family Gene View larger

RAN-RAN, member RAS oncogene family Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAN-RAN, member RAS oncogene family Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAN-RAN, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014518
Product type: DNA & cDNA
Ncbi symbol: RAN
Origin species: Human
Product name: RAN-RAN, member RAS oncogene family Gene
Size: 2ug
Accessions: BC014518
Gene id: 5901
Gene description: RAN, member RAS oncogene family
Synonyms: RAN, member RAS oncogene family; guanosine triphosphatase Ran; GTPase Ran; GTP-binding nuclear protein Ran; ARA24; Gsp1; TC4; OK/SW-cl.81; RanGTPase; androgen receptor-associated protein 24; member RAS oncogene family; ras-like protein TC4; ras-related nuclear protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcgcagggagagccccaggtccagttcaaacttgtattggttggtgatggtggtactggaaaaacgaccttcgtgaaacgtcatttgactggtgaatttgagaagaagtatgtagccaccttgggtgttgaggttcatcccctagtgttccacaccaacagaggacctattaagttcaatgtatgggacacagccggccaggagaaattcggtggactgagagatggctattatatccaagcccagtgtgccatcataatgtttgatgtaacatcgagagttacttacaagaatgtgcctaactggcatagagatctggtacgagtgtgtgaaaacatccccattgtgttgtgtggcaacaaagtggatattaaggacaggaaagtgaaggcgaaatccattgtcttccaccgaaagaagaatcttcagtactacgacatttctgccaaaagtaactacaactttgaaaagcccttcctctggcttgctaggaagctcattggagaccctaacttggaatttgttgccatgcctgctctcgccccaccagaagttgtcatggacccagctttggcagcacagtatgagcacgacttagaggttgctcagacaactgctctcccggatgaggatgatgacctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melanoma antigen family H, 1
- NIPA-like domain containing 3
- ubiquitin domain containing 1
- ribose 5-phosphate isomerase A

Buy RAN-RAN, member RAS oncogene family Gene now

Add to cart