Login to display prices
Login to display prices
F8-coagulation factor VIII, procoagulant component Gene View larger

F8-coagulation factor VIII, procoagulant component Gene

PTXBC022513

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of F8-coagulation factor VIII, procoagulant component Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about F8-coagulation factor VIII, procoagulant component Gene

Proteogenix catalog: PTXBC022513
Ncbi symbol: F8
Product name: F8-coagulation factor VIII, procoagulant component Gene
Size: 2ug
Accessions: BC022513
Gene id: 2157
Gene description: coagulation factor VIII, procoagulant component
Synonyms: AHF; DXS1253E; F8B; F8C; FVIII; HEMA; coagulation factor VIII; antihemophilic factor; coagulation factor VIII A1 domain; coagulation factor VIII C2 domain; coagulation factor VIII, procoagulant component; coagulation factor VIIIc; factor VIII F8B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggatccaagaccctgggaaggtcttctttggcaatgtggattcatctgggataaaacacaatatttttaaccctccaattattgctcgatacatccgtttgcacccaactcattatagcattcgcagcactcttcgcatggagttgatgggctgtgatttaaatagttgcagcatgccattgggaatggagagtaaagcaatatcagatgcacagattactgcttcatcctactttaccaatatgtttgccacctggtctccttcaaaagctcgacttcacctccaagggaggagtaatgcctggagacctcaggtgaataatccaaaagagtggctgcaagtggacttccagaagacaatgaaagtcacaggagtaactactcagggagtaaaatctctgcttaccagcatgtatgtgaaggagttcctcatctccagcagtcaagatggccatcagtggactctcttttttcagaatggcaaagtaaaggtttttcagggaaatcaagactccttcacacctgtggtgaactctctagacccaccgttactgactcgctaccttcgaattcacccccagagttgggtgcaccagattgccctgaggatggaggttctgggctgcgaggcacaggacctctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: