Login to display prices
Login to display prices
GORASP1-golgi reassembly stacking protein 1, 65kDa Gene View larger

GORASP1-golgi reassembly stacking protein 1, 65kDa Gene

PTXBC008928

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GORASP1-golgi reassembly stacking protein 1, 65kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GORASP1-golgi reassembly stacking protein 1, 65kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008928
Product type: DNA & cDNA
Ncbi symbol: GORASP1
Origin species: Human
Product name: GORASP1-golgi reassembly stacking protein 1, 65kDa Gene
Size: 2ug
Accessions: BC008928
Gene id: 64689
Gene description: golgi reassembly stacking protein 1, 65kDa
Synonyms: GOLPH5; GRASP65; P65; Golgi reassembly-stacking protein 1; Golgi peripheral membrane protein p65; Golgi phosphoprotein 5; Golgi reassembly and stacking protein 1; golgi reassembly stacking protein 1, 65kDa; golgi reassembly-stacking protein of 65 kDa; golgi reassembly stacking protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcctgggcgtcagcgctgagcagcccgcaggcggcgccgagggcttccacctccacggggtgcaggagaactccccagcccagcaggcgggcctggagccctactttgacttcatcatcaccattgggcactcgaggctgaacaaggagaatgacaccctgaaggcactactgaaagccaatgtggagaagcccgtgaagctggaggtgttcaatatgaagaccatgagggtgcgcgaggtggaggtggtgcccagcaacatgtggggcggccagggcctactgggtgccagtgtgcgcttctgcagcttccgcagggccagtgagcaggtgtggcatgtgctggatgtggaaccatcttcacctgctgcccttgccggcctgcgcccctacacagactatgtggttggttcggaccagattctccaggagtccgaggacttctttacgctcatcgagtctcatgaggggaagcccttgaagctgatggtgtataactccaagtcagactcctgccgggagtctgggatgtggcattggctatgggtatctacaccggatcccaactcagccccccagctaccacaagaagccacctggcaccccaccaccttctgctctaccacttggtgccccaccacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coagulation factor VIII, procoagulant component
- DnaJ (Hsp40) homolog, subfamily B, member 9
- alkB, alkylation repair homolog 8 (E. coli)
- phosphatidylinositol transfer protein, beta