NMNAT3-nicotinamide nucleotide adenylyltransferase 3 Gene View larger

NMNAT3-nicotinamide nucleotide adenylyltransferase 3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NMNAT3-nicotinamide nucleotide adenylyltransferase 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NMNAT3-nicotinamide nucleotide adenylyltransferase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034374
Product type: DNA & cDNA
Ncbi symbol: NMNAT3
Origin species: Human
Product name: NMNAT3-nicotinamide nucleotide adenylyltransferase 3 Gene
Size: 2ug
Accessions: BC034374
Gene id: 349565
Gene description: nicotinamide nucleotide adenylyltransferase 3
Synonyms: FKSG76; PNAT-3; PNAT3; nicotinamide/nicotinic acid mononucleotide adenylyltransferase 3; NMN adenylyltransferase 3; NMN/NaMN adenylyltransferase 3; NaMN adenylyltransferase 3; nicotinamide mononucleotide adenylyltransferase 3; nicotinate-nucleotide adenylyltransferase 3; pyridine nucleotide adenylyltransferase 3; nicotinamide nucleotide adenylyltransferase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtaccaggtcatccagggtatcatctctcctgtcaacgacacctatgggaagaaagacctcgcagcttctcatcaccgagtggccatggcccggctggccctgcagacatccgactggatccgggtggacccttgggagagtgagcaggcacagtggatggagacagtgaaggtgctgaggcatcatcacagcaaactgctcagatctccaccccagatggaaggcccagaccatggcaaggcactcttctcgacccctgcagctgtgcctgagctgaagcttctctgtggggcagacgtcttgaagaccttccagacccccaacctctggaaggatgcgcacatccaggaaatagtggagaagtttggcttggtgtgcgtgggccgagtaggtcacgacccaaaaggttacatcgcagaatctcccatcctacggatgcaccagcacaacattcacctggccaaggagcctgtgcagaatgagatcagtgccacatacatcaggcgagccttgggccaagggcagagcgtaaagtacctgattcccgatgctgtcatcacgtacatcaaggaccatggcctctacaccaagggcagtacctggaaaggcaaaagcacccagagcactgagggcaagacaagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cell division cycle 34 homolog (S. cerevisiae)
- complement component 1, q subcomponent, C chain
- granzyme H (cathepsin G-like 2, protein h-CCPX)
- Spi-C transcription factor (Spi-1/PU.1 related)

Buy NMNAT3-nicotinamide nucleotide adenylyltransferase 3 Gene now

Add to cart