Login to display prices
Login to display prices
C19orf36-chromosome 19 open reading frame 36 Gene View larger

C19orf36-chromosome 19 open reading frame 36 Gene

PTXBC014609

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf36-chromosome 19 open reading frame 36 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf36-chromosome 19 open reading frame 36 Gene

Proteogenix catalog: PTXBC014609
Ncbi symbol: C19orf36
Product name: C19orf36-chromosome 19 open reading frame 36 Gene
Size: 2ug
Accessions: BC014609
Gene id: 113177
Gene description: chromosome 19 open reading frame 36
Synonyms: C19orf36; IMAGE:4215339; izumo sperm-egg fusion protein 4; sperm 22 kDa protein c113; IZUMO family member 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccctgctgctgtgcctggtgtgcctgacggcggcgctggcccacggctgtctgcactgccacagcaacttctccaagaagttctccttctaccgccaccatgtgaacttcaagtcctggtgggtgggcgacatccccgtgtcaggggcgctgctcaccgactggagcgacgacacgatgaaggagctgcacctggccatccccgccaagatcacccgggagaagctggaccaagtggcgacagcagtgtaccagatgatggatcagctgtaccaggggaagatgtacttccccgggtatttccccaacgagctgcgaaacatcttccgggagcaggtgcacctcatccagaacgccatcatcgaaagccgcatcgactgtcagcaccgctgtggcatcttccagtacgagaccatctcctgcaacaactgcacagactcgcacgtcgcctgctttggctataactgcgagtcctcggcgcagtggaagtcagctgtccagggcctcctgaactacataaataactggcacaaacaggacacgagcatgagcctggtatcgccagccttaaggtgtctggagcccccacacttggccaacctgaccttggaagatgctgctgagtgtctcaagcagcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: