No products
Prices are tax excluded
PTXBC015944
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015944 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIA1 |
| Origin species: | Human |
| Product name: | TIA1-TIA1 cytotoxic granule-associated RNA binding protein Gene |
| Size: | 2ug |
| Accessions: | BC015944 |
| Gene id: | 7072 |
| Gene description: | TIA1 cytotoxic granule-associated RNA binding protein |
| Synonyms: | TIA1 cytotoxic granule associated RNA binding protein; WDM; nucleolysin TIA-1 isoform p40; T-cell-restricted intracellular antigen-1; p40-TIA-1 (containing p15-TIA-1) |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggacgagatgcccaagactctatacgtcggtaacctttccagagatgtgacagaagctctaattctgcaactctttagccagattggaccttgtaaaaactgcaaaatgattatggatacagctggaaatgatccctattgttttgtggagtttcatgagcatcgtcatgcagctgcagcattagctgctatgaatggacggaagataatgggtaaggaagtcaaagtgaattgggcaacaacccctagcagtcaaaagaaagatacaagcagtagtaccgttgtcagcacacagcgttcacaagatcatttccatgtctttgttggtgatctcagcccagaaattacaactgaagatataaaagctgcttttgcaccatttggaagaatatcagatgcccgagtggtaaaagacatggcaacaggaaagtctaagggatatggctttgtctcctttttcaacaaatgggatgctgaaaacgccattcaacagatgggtggccagtggcttggtggaagacaaatcagaactaactgggcaacccgaaagcctcccgctccaaagagtacatatgagtgtaggtgtattggagaagaaaaggaaatgtggaattttggagaaaaatacgctagattttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - ChaC, cation transport regulator homolog 1 (E. coli) - nucleotide binding protein 2 (MinD homolog, E. coli) - cleavage and polyadenylation specific factor 3-like - cleavage and polyadenylation specific factor 3-like |