Login to display prices
Login to display prices
CPSF3L-cleavage and polyadenylation specific factor 3-like Gene View larger

CPSF3L-cleavage and polyadenylation specific factor 3-like Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CPSF3L-cleavage and polyadenylation specific factor 3-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CPSF3L-cleavage and polyadenylation specific factor 3-like Gene

Proteogenix catalog: PTXBC008041
Ncbi symbol: CPSF3L
Product name: CPSF3L-cleavage and polyadenylation specific factor 3-like Gene
Size: 2ug
Accessions: BC008041
Gene id: 54973
Gene description: cleavage and polyadenylation specific factor 3-like
Synonyms: CPSF73L; INT11; INTS11; RC-68; RC68; integrator complex subunit 11; CPSF3-like protein; cleavage and polyadenylation-specific factor 3-like protein; protein related to CPSF subunits of 68 kDa; related to CPSF subunits 68 kDa; cleavage and polyadenylation specific factor 3-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgagatcagagtcacgcccttgggggccggccaggacgtgggccgaagctgcatcctggtctccattgcgggcaagaatgtcatgctggactgtggaatgcacatgggcttcaatgacgaccgacgcttccctgacttctcctacatcacccagaacggccgcctaacagacttcctggactgtgtgatcattagccacttccacctggaccactgcggggcactcccctacttcagcgagatggtgggctacgacggccccatctacatgactcaccccacccaggccatctgccccatcttgctggaggactaccgcaagatcgccgtagacaagaagggcgaggccaacttcttcacctcccagatgatcaaagactgcatcctcctggagaccttctgggagcgcatgaacctgaaggtgcccatctacttctccacggggctgaccgagaaggccaaccactactacaagctgttcatcccctggaccaaccagaagatccgcaagacttttgtgcagaggaacatgtttgagttcaagcacatcaaggccttcgaccgggcttttgctgacaacccaggaccgatggttgtgtttgccacgccaggaatgctgcacgctgggcagtccctgcagatcttccggaaatgggccggaaacgaaaagaacatggtcatcatgcccggctactgcgtgcagggcaccgtcggccacaagatcctcagcgggcagcggaagctcgagatggaggggcggcaggtgctggaggtcaagatgcaggtggagtacatgtcattcagcgcacacgcggacgccaagggcatcatgcagctggtgtcctcagagcaagccctcaaagagctgggtctggctgagcaccagctgcgcttcacctgccgcgtgcacctgcatgacacacgcaaggagcaggagacggcattgcgcgtctacagccacctcaagagcgtcctgaaggaccactgtgtgcagcacctcccggacggctctgtgactgtggagtccgtcctcctccaggccgccgccccttctgaggacccaggcaccaaggtgctgctggtctcctggacctaccaggacgaggagctggggagcttcctcacatctctgctgaagaagggcctcccccaggcccccagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: