Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CPSF3L-cleavage and polyadenylation specific factor 3-like Gene
PTXBC008041
New product
Data sheet of CPSF3L-cleavage and polyadenylation specific factor 3-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CPSF3L-cleavage and polyadenylation specific factor 3-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008041 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CPSF3L |
| Origin species: | Human |
| Product name: | CPSF3L-cleavage and polyadenylation specific factor 3-like Gene |
| Size: | 2ug |
| Accessions: | BC008041 |
| Gene id: | 54973 |
| Gene description: | cleavage and polyadenylation specific factor 3-like |
| Synonyms: | CPSF73L; INT11; INTS11; RC-68; RC68; integrator complex subunit 11; CPSF3-like protein; cleavage and polyadenylation-specific factor 3-like protein; protein related to CPSF subunits of 68 kDa; related to CPSF subunits 68 kDa; cleavage and polyadenylation specific factor 3-like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgagatcagagtcacgcccttgggggccggccaggacgtgggccgaagctgcatcctggtctccattgcgggcaagaatgtcatgctggactgtggaatgcacatgggcttcaatgacgaccgacgcttccctgacttctcctacatcacccagaacggccgcctaacagacttcctggactgtgtgatcattagccacttccacctggaccactgcggggcactcccctacttcagcgagatggtgggctacgacggccccatctacatgactcaccccacccaggccatctgccccatcttgctggaggactaccgcaagatcgccgtagacaagaagggcgaggccaacttcttcacctcccagatgatcaaagactgcatcctcctggagaccttctgggagcgcatgaacctgaaggtgcccatctacttctccacggggctgaccgagaaggccaaccactactacaagctgttcatcccctggaccaaccagaagatccgcaagacttttgtgcagaggaacatgtttgagttcaagcacatcaaggccttcgaccgggcttttgctgacaacccaggaccgatggttgtgtttgccacgccaggaatgctgcacgctgggcagtccctgcagatcttccggaaatgggccggaaacgaaaagaacatggtcatcatgcccggctactgcgtgcagggcaccgtcggccacaagatcctcagcgggcagcggaagctcgagatggaggggcggcaggtgctggaggtcaagatgcaggtggagtacatgtcattcagcgcacacgcggacgccaagggcatcatgcagctggtgtcctcagagcaagccctcaaagagctgggtctggctgagcaccagctgcgcttcacctgccgcgtgcacctgcatgacacacgcaaggagcaggagacggcattgcgcgtctacagccacctcaagagcgtcctgaaggaccactgtgtgcagcacctcccggacggctctgtgactgtggagtccgtcctcctccaggccgccgccccttctgaggacccaggcaccaaggtgctgctggtctcctggacctaccaggacgaggagctggggagcttcctcacatctctgctgaagaagggcctcccccaggcccccagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein-like 2 (nucleolar) - rho/rac guanine nucleotide exchange factor (GEF) 2 - transmembrane and ubiquitin-like domain containing 2 - pleckstrin homology-like domain, family B, member 1 |