CPSF3L-cleavage and polyadenylation specific factor 3-like Gene View larger

CPSF3L-cleavage and polyadenylation specific factor 3-like Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CPSF3L-cleavage and polyadenylation specific factor 3-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CPSF3L-cleavage and polyadenylation specific factor 3-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013904
Product type: DNA & cDNA
Ncbi symbol: CPSF3L
Origin species: Human
Product name: CPSF3L-cleavage and polyadenylation specific factor 3-like Gene
Size: 2ug
Accessions: BC013904
Gene id: 54973
Gene description: cleavage and polyadenylation specific factor 3-like
Synonyms: CPSF73L; INT11; INTS11; RC-68; RC68; integrator complex subunit 11; CPSF3-like protein; cleavage and polyadenylation-specific factor 3-like protein; protein related to CPSF subunits of 68 kDa; related to CPSF subunits 68 kDa; cleavage and polyadenylation specific factor 3-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttgagttcaagcacatcaaggccttcgaccgggcttttgctgacaacccaggaccgatggttgtgtttgccacgccaggaatgctgcacgctgggcagtccctgcagatcttccggaaatgggccggaaacgaaaagaacatggtcatcatgcccggctactgcgtgcagggcaccgtcggccacaagatcctcagcgggcagcggaagctcgagatggaggggcggcaggtgctggaggtcaagatgcaggtggagtacatgtcattcagcgcacacgcggacgccaagggcatcatgcagctggtgggccaggcagagccggagagcgtgctgctggtgcatggcgaggccaagaagatggagttcctgaagcagaagatcgagcaggagctccgggtcaactgctacatgccggccaatggcgagacggtgacgctgcccacaagccccagcatccccgtaggcatctcgctggggctgctgaagcgggagatggcgcaggggctgctccctgaggccaagaagcctcggctcctgcacggcaccctgatcatgaaggacagcaacttccggctggtgtcctcagagcaagccctcaaagagctgggtctggctgagcaccagctgcgcttcacctgccgcgtgcacctgcatgacacacgcaaggagcaggagacggcattgcgcgtctacagccacctcaagagcgtcctgaaggaccactgtgtgcagcacctcccagacggctctgtgactgtggagtccgtcctcctccaggccgccgccccttctgaggacccaggcaccaaggtgctgctggtctcctggacctaccaggacgaggagctggggagcttcctcacatctctgctgaagaagggcctcccccaggcccccagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cleavage and polyadenylation specific factor 3-like
- guanine nucleotide binding protein-like 2 (nucleolar)
- rho/rac guanine nucleotide exchange factor (GEF) 2
- transmembrane and ubiquitin-like domain containing 2

Buy CPSF3L-cleavage and polyadenylation specific factor 3-like Gene now

Add to cart