CHAC1-ChaC, cation transport regulator homolog 1 (E. coli) Gene View larger

CHAC1-ChaC, cation transport regulator homolog 1 (E. coli) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHAC1-ChaC, cation transport regulator homolog 1 (E. coli) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHAC1-ChaC, cation transport regulator homolog 1 (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001683
Product type: DNA & cDNA
Ncbi symbol: CHAC1
Origin species: Human
Product name: CHAC1-ChaC, cation transport regulator homolog 1 (E. coli) Gene
Size: 2ug
Accessions: BC001683
Gene id: 79094
Gene description: ChaC, cation transport regulator homolog 1 (E. coli)
Synonyms: glutathione-specific gamma-glutamylcyclotransferase 1; ChaC, cation transport regulator homolog 1; ChaC, cation transport regulator-like 1; blocks Notch protein; botch; gamma-GCG 1; gamma-GCT acting on glutathione homolog 1; ChaC glutathione specific gamma-glutamylcyclotransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcaggagtctgcagccccgaacaccccgcccacctcgcagtcccctacgccgtccgctcagttcccccgaaacgacggcgaccctcaagcgctgtggattttcgggtacggctccctggtgtggaggcccgacttcgcctacagcgacagccgtgtgggcttcgtgcgcggctacagccgccgtttctggcagggagacaccttccatcggggcagcgacaagatgcctggccgtgtggtgacgctccttgaagatcatgagggctgcacttggggcgtggcataccaagtgcaaggggagcaggtaagcaaggccctgaagtacctgaatgtgcgagaggcagtgcttggtggctacgataccaaggaggtcaccttctatccccaagatgctcctgaccaaccactgaaggcattggcctatgtggccaccccacagaaccctggttacctgggccctgcgcctgaagaggccattgccacgcagatcctggcctgccggggcttctccggccacaaccttgaatacttgctgcgtctggcagacttcatgcagctctgtgggcctcaggcgcaggacgagcacctggcagccatcgtggacgctgtgggcaccatgttgccctgcttctgccccaccgagcaggctctggcgctggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nucleotide binding protein 2 (MinD homolog, E. coli)
- cleavage and polyadenylation specific factor 3-like
- cleavage and polyadenylation specific factor 3-like
- guanine nucleotide binding protein-like 2 (nucleolar)

Buy CHAC1-ChaC, cation transport regulator homolog 1 (E. coli) Gene now

Add to cart