Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUBP2-nucleotide binding protein 2 (MinD homolog, E. coli) Gene
PTXBC008005
New product
Data sheet of NUBP2-nucleotide binding protein 2 (MinD homolog, E. coli) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUBP2-nucleotide binding protein 2 (MinD homolog, E. coli) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008005 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUBP2 |
| Origin species: | Human |
| Product name: | NUBP2-nucleotide binding protein 2 (MinD homolog, E. coli) Gene |
| Size: | 2ug |
| Accessions: | BC008005 |
| Gene id: | 10101 |
| Gene description: | nucleotide binding protein 2 (MinD homolog, E. coli) |
| Synonyms: | cytosolic Fe-S cluster assembly factor NUBP2; CFD1; NBP 2; NUBP1; homolog of yeast cytosolic Fe-S cluster deficient 1; nucleotide binding protein 2 (MinD homolog, E. coli); nucleotide binding protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggcggcggccgagcctggaaacctggccggcgtcaggcacatcatcctggtcctctcaggaaaggggggcgttgggaaaagcaccatctccacggagctggccctggcactgcgccatgcaggcaagaaggtgggaatcctggatgtggacctgtgtggccccagtataccccgcatgctcggggcgcagggcagggctgtgcaccagtgcgaccgcggctgggcacccgtcttcctggaccgggagcagagcatctcgctcatgtctgtgggcttcctgctggagaagccggacgaggccgtggtgtggagaggccccaagaaaaacgcgctgataaagcagtttgtgtccgacgtggcctggggggagctggactacctggtggtggacacgcccccggggacctccgatgagcacatggccaccatagaagccctgcgtccctaccagcccctgggggccctcgtggtcaccacgccccaggcggtgtccgtgggggacgtgaggcgcgagctgaccttctgtaggaagacgggcttgcgggtgatgggaatcgtggagaatatgagcggcttcacctgcccacactgcacggagtgcaccagcgtcttctccaggggcggcggagaggagctggcccagctcgccggggtgcccttcttaggctccgtgcccctggaccctgcgctcatgaggaccctggaggagggccacgacttcatccaggagttccccgggagccccgccttcgctgcactcacctccatagcccagaagattctggacgcgacgcccgcgtgcctcccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cleavage and polyadenylation specific factor 3-like - cleavage and polyadenylation specific factor 3-like - guanine nucleotide binding protein-like 2 (nucleolar) - rho/rac guanine nucleotide exchange factor (GEF) 2 |