Login to display prices
Login to display prices
NUBP2-nucleotide binding protein 2 (MinD homolog, E. coli) Gene View larger

NUBP2-nucleotide binding protein 2 (MinD homolog, E. coli) Gene

PTXBC008005

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUBP2-nucleotide binding protein 2 (MinD homolog, E. coli) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NUBP2-nucleotide binding protein 2 (MinD homolog, E. coli) Gene

Proteogenix catalog: PTXBC008005
Ncbi symbol: NUBP2
Product name: NUBP2-nucleotide binding protein 2 (MinD homolog, E. coli) Gene
Size: 2ug
Accessions: BC008005
Gene id: 10101
Gene description: nucleotide binding protein 2 (MinD homolog, E. coli)
Synonyms: cytosolic Fe-S cluster assembly factor NUBP2; CFD1; NBP 2; NUBP1; homolog of yeast cytosolic Fe-S cluster deficient 1; nucleotide binding protein 2 (MinD homolog, E. coli); nucleotide binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggcggcggccgagcctggaaacctggccggcgtcaggcacatcatcctggtcctctcaggaaaggggggcgttgggaaaagcaccatctccacggagctggccctggcactgcgccatgcaggcaagaaggtgggaatcctggatgtggacctgtgtggccccagtataccccgcatgctcggggcgcagggcagggctgtgcaccagtgcgaccgcggctgggcacccgtcttcctggaccgggagcagagcatctcgctcatgtctgtgggcttcctgctggagaagccggacgaggccgtggtgtggagaggccccaagaaaaacgcgctgataaagcagtttgtgtccgacgtggcctggggggagctggactacctggtggtggacacgcccccggggacctccgatgagcacatggccaccatagaagccctgcgtccctaccagcccctgggggccctcgtggtcaccacgccccaggcggtgtccgtgggggacgtgaggcgcgagctgaccttctgtaggaagacgggcttgcgggtgatgggaatcgtggagaatatgagcggcttcacctgcccacactgcacggagtgcaccagcgtcttctccaggggcggcggagaggagctggcccagctcgccggggtgcccttcttaggctccgtgcccctggaccctgcgctcatgaggaccctggaggagggccacgacttcatccaggagttccccgggagccccgccttcgctgcactcacctccatagcccagaagattctggacgcgacgcccgcgtgcctcccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: