Login to display prices
Login to display prices
ZC3HC1-zinc finger, C3HC-type containing 1 Gene View larger

ZC3HC1-zinc finger, C3HC-type containing 1 Gene

PTXBC028917

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZC3HC1-zinc finger, C3HC-type containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZC3HC1-zinc finger, C3HC-type containing 1 Gene

Proteogenix catalog: PTXBC028917
Ncbi symbol: ZC3HC1
Product name: ZC3HC1-zinc finger, C3HC-type containing 1 Gene
Size: 2ug
Accessions: BC028917
Gene id: 51530
Gene description: zinc finger, C3HC-type containing 1
Synonyms: HSPC216; nuclear-interacting partner of ALK; hematopoietic stem/progenitor cell protein 216; nuclear interacting partner of anaplastic lymphoma kinase (ALK); zinc finger C3HC-type containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgacctggatgcatcctttggcctgaccagctccccaatcccaggccttgaggggcgaccagagcgcttacctctggtgcctgaatctcctcggaggatgatgacccggagccaggatgccactttctccccaggctcagagcaggctgaaaagagccctggtcccattgtctctcgaactcggagctgggactcttccagtcctgttgaccgtcctgagccagaggctgctagccccaccaccagaactcgcccagtgacccgaagcatgggaacaggagacacccctggcctggaggtaccatctagccctctgcggaaagccaagcgagctcgcctctgctcctccagcagttcggacacatcttcccgaagcttctttgatcccacctctcagcatagagactggtgcccttgggtgaatatcacacttggcaaagaaagcagggagaatggtggaactgaaccagatgccagcgccccagcagagccaggctggaaagcagtgctgaccatcctcttggcgcacaaacagtctagccagccagctgaaacggactccatgagtctctctgagaaatcaaggaaagtattccgaatatttcggcagtgggaatctctgtgctcatgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: