COMMD10-COMM domain containing 10 Gene View larger

COMMD10-COMM domain containing 10 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COMMD10-COMM domain containing 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about COMMD10-COMM domain containing 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005179
Product type: DNA & cDNA
Ncbi symbol: COMMD10
Origin species: Human
Product name: COMMD10-COMM domain containing 10 Gene
Size: 2ug
Accessions: BC005179
Gene id: 51397
Gene description: COMM domain containing 10
Synonyms: PTD002; COMM domain-containing protein 10; COMM domain containing 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggtccccgcggcgctgatcctacgggagagccccagcatgaagaaagcagtgtcactgataaatgcaatagatacaggaagatttccacggttgctcactcggattcttcaaaaacttcacctgaaggctgagagcagtttcagtgaagaagaggaagaaaaacttcaagcggcattttctctagagaaacaagatcttcacctagttcttgaaacaatatcatttattttagaacaggcagtgtatcacaatgtgaagccagcagctttgcagcagcaattagagaacattcatcttagacaagacaaagctgaagcatttgtcaatacgtggtcttctatgggtcaagaaacagttgaaaagttccggcagagaattctggctccctgtaagctagagaccgttggatggcagcttaaccttcagatggctcactctgctcaagcaaaactaaaatctcctcaagctgtgttacaactcggagtgaacaatgaagattcaaagagcctggagaaagttcttgtggaattcagtcacaaggagttgtttgatttctataacaagctagagactatacaagcacagctggattcccttacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 125
- PRELI domain containing 1
- transmembrane protein 86B
- Epstein-Barr virus induced 3

Buy COMMD10-COMM domain containing 10 Gene now

Add to cart