Login to display prices
Login to display prices
RPS4X-ribosomal protein S4, X-linked Gene View larger

RPS4X-ribosomal protein S4, X-linked Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS4X-ribosomal protein S4, X-linked Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPS4X-ribosomal protein S4, X-linked Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007308
Product type: DNA & cDNA
Ncbi symbol: RPS4X
Origin species: Human
Product name: RPS4X-ribosomal protein S4, X-linked Gene
Size: 2ug
Accessions: BC007308
Gene id: 6191
Gene description: ribosomal protein S4, X-linked
Synonyms: CCG2; DXS306; RPS4; SCAR; SCR10; 40S ribosomal protein S4, X isoform; cell cycle gene 2; ribosomal protein S4X isoform; single copy abundant mRNA protein; single-copy abundant mRNA; ribosomal protein S4, X-linked
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagcggttcattaaaatcgatggcaaggtccgaactgatataacctaccctgctggattcatggatgtcatcagcattgacaagacgggagagaatttccgtctgatctatgacaccaagggtcgctttgctgtacatcgtattacacctgaggaggccaagtacaagttgtgcaaagtgagaaagatctttgtgggcacaaaaggaatccctcatctggtgactcatgatgcccgcaccatccgctaccccgatcccctcatcaaggtgaatgataccattcagattgatttagagactggcaagattactgatttcatcaagttcgacactggtaacctgtgtatggtgactggaggtgctaacctaggaagaattggtgtgatcaccaacagagagaggcaccctggatcttttgacgtggttcacgtgaaagatgccaatggcaacagctttgccactcgactttccaacatttttgttattggcaagggcaacaaaccatggatttctcttccccgaggaaagggtatccgcctcaccattgctgaagagagagacaaaagactggcggccaaacagagcagtgggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutathione S-transferase mu 4
- ATP/GTP binding protein-like 2
- deafness, autosomal dominant 5
- neurogenic differentiation 1