RHEBL1-Ras homolog enriched in brain like 1 Gene View larger

RHEBL1-Ras homolog enriched in brain like 1 Gene

PTXBC027482

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RHEBL1-Ras homolog enriched in brain like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RHEBL1-Ras homolog enriched in brain like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027482
Product type: DNA & cDNA
Ncbi symbol: RHEBL1
Origin species: Human
Product name: RHEBL1-Ras homolog enriched in brain like 1 Gene
Size: 2ug
Accessions: BC027482
Gene id: 121268
Gene description: Ras homolog enriched in brain like 1
Synonyms: GTPase RhebL1; RHEBL1c; Ras homolog enriched in brain like 1 c; ras homolog enriched in brain like-1 c; ras homolog enriched in brain-like protein 1; rheb-like protein 1; rheb2; Ras homolog enriched in brain like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgctagtccgctacaggaaggtggtcatcctcggataccgctgtgtagggaagacatctttggcacatcaatttgtggaaggcgagttctcggaaggctacgatcctacagtggagaatacttacagcaagatagtgactcttggcaaagatgagtttcacctacatttggtggacacagcagggcaggatgagtacagcattctgccctattcattcatcattggggtccatggttatgtgcttgtgtattctgtcacctctctgcatagcttccaagtcattgagagtctgtaccaaaagctacatgaaggccatgggaaaacccgggtgccagtggttctagtggggaacaaggcagatctctctccagagagagaggtacaggcagttgaaggaaagaagctggcagagtcctggggtgcgacatttatggagtcatctgctcgagagaatcagctgactcaaggcatcttcaccaaagtcatccaggagattgcccgtgtggagaattcctatgggcaagagcgtcgctgccatctcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GAR1 ribonucleoprotein homolog (yeast)
- Na+/H+ exchanger domain containing 1
- GINS complex subunit 4 (Sld5 homolog)
- secretory carrier membrane protein 4

Buy RHEBL1-Ras homolog enriched in brain like 1 Gene now

Add to cart