Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RHEBL1-Ras homolog enriched in brain like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RHEBL1-Ras homolog enriched in brain like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027482 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RHEBL1 |
| Origin species: | Human |
| Product name: | RHEBL1-Ras homolog enriched in brain like 1 Gene |
| Size: | 2ug |
| Accessions: | BC027482 |
| Gene id: | 121268 |
| Gene description: | Ras homolog enriched in brain like 1 |
| Synonyms: | GTPase RhebL1; RHEBL1c; Ras homolog enriched in brain like 1 c; ras homolog enriched in brain like-1 c; ras homolog enriched in brain-like protein 1; rheb-like protein 1; rheb2; Ras homolog enriched in brain like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgctagtccgctacaggaaggtggtcatcctcggataccgctgtgtagggaagacatctttggcacatcaatttgtggaaggcgagttctcggaaggctacgatcctacagtggagaatacttacagcaagatagtgactcttggcaaagatgagtttcacctacatttggtggacacagcagggcaggatgagtacagcattctgccctattcattcatcattggggtccatggttatgtgcttgtgtattctgtcacctctctgcatagcttccaagtcattgagagtctgtaccaaaagctacatgaaggccatgggaaaacccgggtgccagtggttctagtggggaacaaggcagatctctctccagagagagaggtacaggcagttgaaggaaagaagctggcagagtcctggggtgcgacatttatggagtcatctgctcgagagaatcagctgactcaaggcatcttcaccaaagtcatccaggagattgcccgtgtggagaattcctatgggcaagagcgtcgctgccatctcatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GAR1 ribonucleoprotein homolog (yeast) - Na+/H+ exchanger domain containing 1 - GINS complex subunit 4 (Sld5 homolog) - secretory carrier membrane protein 4 |