Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KHDRBS3-KH domain containing, RNA binding, signal transduction associated 3 Gene
PTXBC032606
New product
Data sheet of KHDRBS3-KH domain containing, RNA binding, signal transduction associated 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KHDRBS3-KH domain containing, RNA binding, signal transduction associated 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032606 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KHDRBS3 |
| Origin species: | Human |
| Product name: | KHDRBS3-KH domain containing, RNA binding, signal transduction associated 3 Gene |
| Size: | 2ug |
| Accessions: | BC032606 |
| Gene id: | 10656 |
| Gene description: | KH domain containing, RNA binding, signal transduction associated 3 |
| Synonyms: | Etle; SALP; SLM-2; SLM2; T-STAR; TSTAR; etoile; KH domain-containing, RNA-binding, signal transduction-associated protein 3; KH domain containing, RNA binding, signal transduction associated 3; RNA-binding protein T-Star; Sam68-like phosphotyrosine protein, T-STAR; sam68-like mammalian protein 2; KH RNA binding domain containing, signal transduction associated 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagaagtacctgcccgagctgatggcggagaaggactccctggacccctccttcacgcacgccctgcgcctggtgaaccaagaaatagaaaagtttcaaaaaggagaaggcaaggatgaagaaaagtacatcgatgtggtgattaataagaacatgaagctgggacagaaagtgttaattcccgtaaaacagttccctaagttcaactttgtggggaaacttttgggtccacgtggcaattctctgaagcgtttacaagaagaaaccttgacaaaaatgtccatccttgggaaaggttccatgagagacaaggccaaggaagaagagttgaggaaaagtggagaagcgaagtacttccatctcaatgatgatctccatgttctcattgaagtgtttgccccacctgcagaagcttatgccaggatgggacatgctttggaagaaatcaaaaagttcctcatccctgattataatgatgagatcaggcaagcacagctccaggagttaacatatttgaatggtggttcagaaaatgcagatgttccagtggttcgagggaaacccaccttgcgtacaagaggtgtaccagccccagcaataaccaggggaaggggaggagttacagcccggccagttggagttgtagtaccacgagggacgccaactcccagaggagtcctgtccacccgagggccagtgagtcggggaagaggacttctcactcccagagcaagaggagtccccccaactgggtacagacctccaccgccacccccgacacaagagacttatggagaatatgactatgatgatggatatggcactgcttatgatgaacagagttatgattcctatgataacagctatagcaccccagcccaaagtggtgctgattactatgattacggacatggactcagtgaggagacttatgattcctacgggcaagaagagtggactaactcaagacacaaggcaccttcagcgaggacagcaaagggcgtctacagagaccagccatatggcagatactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform - Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide - glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) - pleckstrin homology domain containing, family B (evectins) member 1 |