Login to display prices
Login to display prices
PLEKHB1-pleckstrin homology domain containing, family B (evectins) member 1 Gene View larger

PLEKHB1-pleckstrin homology domain containing, family B (evectins) member 1 Gene

PTXBC008075

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLEKHB1-pleckstrin homology domain containing, family B (evectins) member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PLEKHB1-pleckstrin homology domain containing, family B (evectins) member 1 Gene

Proteogenix catalog: PTXBC008075
Ncbi symbol: PLEKHB1
Product name: PLEKHB1-pleckstrin homology domain containing, family B (evectins) member 1 Gene
Size: 2ug
Accessions: BC008075
Gene id: 58473
Gene description: pleckstrin homology domain containing, family B (evectins) member 1
Synonyms: PHR1; PHRET1; pleckstrin homology domain-containing family B member 1; PH domain containing, retinal 1; PH domain-containing family B member 1; PH domain-containing protein in retina 1; evectin-1; pleckstrin homology domain containing, family B (evectins) member 1; pleckstrin homology domain retinal protein 1; pleckstrin homology domain containing B1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctggtgaggggcggctggctgtggagacagagctccatcctccgccgctggaagcggaactggtttgccctgtggctggacgggaccctgggatactaccacgatgagacagcgcaggacgaggaggaccgtgtgctcatccacttcaatgtccgtgacataaagatcggcccagagtgccatgatgtgcagcccccagagggccggagccgagatggcctgctgactgtgaacctacgggaaggcggccgcctgcacctctgtgcggagaccaaggatgatgccctagcatggaagacagcactgctggaggcaaactccaccccggtgcgcgtctacagcccgtaccaagactactacgaggtggtgccccccaatgcacacgaggccacgtatgtccgcagctactacggaccgccctacgcaggccctggcgtgacgcacgtgatagtgcgggaggatccctgctacagcgccggcgcccctctggccatgggcatgcttgcgggagccgccactggggcggcgctgggctcgctcatgtggtcgccctgctggttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice