Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FCER1A-Fc fragment of IgE, high affinity I, receptor for, alpha polypeptide Gene
PTXBC005912
New product
Data sheet of FCER1A-Fc fragment of IgE, high affinity I, receptor for, alpha polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FCER1A-Fc fragment of IgE, high affinity I, receptor for, alpha polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005912 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FCER1A |
| Origin species: | Human |
| Product name: | FCER1A-Fc fragment of IgE, high affinity I, receptor for, alpha polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC005912 |
| Gene id: | 2205 |
| Gene description: | Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide |
| Synonyms: | FCE1A; FcERI; high affinity immunoglobulin epsilon receptor subunit alpha; Fc IgE receptor, alpha polypeptide; Fc epsilon RI alpha-chain; Fc epsilon receptor Ia; Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide; Fc-epsilon RI-alpha; high affinity immunoglobulin epsilon receptor alpha-subunit; igE Fc receptor subunit alpha; immunoglobulin E receptor, high-affinity, of mast cells, alpha polypeptide; Fc fragment of IgE receptor Ia |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcctgccatggaatcccctactctactgtgtgtagccttactgttcttcgctccagatggcgtgttagcagtccctcagaaacctaaggtctccttgaaccctccatggaatagaatatttaaaggagagaatgtgactcttacatgtaatgggaacaatttctttgaagtcagttccaccaaatggttccacaatggcagcctttcagaagagacaaattcaagtttgaatattgtgaatgccaaatttgaagacagtggagaatacaaatgtcagcaccaacaagttaatgagagtgaacctgtgtacctggaagtcttcagtgactggctgctccttcaggcctctgctgaggtggtgatggagggccagcccctcttcctcaggtgccatggttggaggaactgggatgtgtacaaggtgatctattataaggatggtgaagctctcaagtactggtatgagaaccacaacatctccattacaaatgccacagttgaagacagtggaacctactactgtacgggcaaagtgtggcagctggactatgagtctgagcccctcaacattactgtaataaaagctccgcgtgagaagtactggctacaattttttatcccattgttggtggtgattctgtttgctgtggacacaggattatttatctcaactcagcagcaggtcacatttctcttgaagattaagagaaccaggaaaggcttcagacttctgaacccacatcctaagccaaaccccaaaaacaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) - pleckstrin homology domain containing, family B (evectins) member 1 - VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa - sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 |