Login to display prices
Login to display prices
FCER1A-Fc fragment of IgE, high affinity I, receptor for, alpha polypeptide Gene View larger

FCER1A-Fc fragment of IgE, high affinity I, receptor for, alpha polypeptide Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FCER1A-Fc fragment of IgE, high affinity I, receptor for, alpha polypeptide Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FCER1A-Fc fragment of IgE, high affinity I, receptor for, alpha polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005912
Product type: DNA & cDNA
Ncbi symbol: FCER1A
Origin species: Human
Product name: FCER1A-Fc fragment of IgE, high affinity I, receptor for, alpha polypeptide Gene
Size: 2ug
Accessions: BC005912
Gene id: 2205
Gene description: Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
Synonyms: FCE1A; FcERI; high affinity immunoglobulin epsilon receptor subunit alpha; Fc IgE receptor, alpha polypeptide; Fc epsilon RI alpha-chain; Fc epsilon receptor Ia; Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide; Fc-epsilon RI-alpha; high affinity immunoglobulin epsilon receptor alpha-subunit; igE Fc receptor subunit alpha; immunoglobulin E receptor, high-affinity, of mast cells, alpha polypeptide; Fc fragment of IgE receptor Ia
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcctgccatggaatcccctactctactgtgtgtagccttactgttcttcgctccagatggcgtgttagcagtccctcagaaacctaaggtctccttgaaccctccatggaatagaatatttaaaggagagaatgtgactcttacatgtaatgggaacaatttctttgaagtcagttccaccaaatggttccacaatggcagcctttcagaagagacaaattcaagtttgaatattgtgaatgccaaatttgaagacagtggagaatacaaatgtcagcaccaacaagttaatgagagtgaacctgtgtacctggaagtcttcagtgactggctgctccttcaggcctctgctgaggtggtgatggagggccagcccctcttcctcaggtgccatggttggaggaactgggatgtgtacaaggtgatctattataaggatggtgaagctctcaagtactggtatgagaaccacaacatctccattacaaatgccacagttgaagacagtggaacctactactgtacgggcaaagtgtggcagctggactatgagtctgagcccctcaacattactgtaataaaagctccgcgtgagaagtactggctacaattttttatcccattgttggtggtgattctgtttgctgtggacacaggattatttatctcaactcagcagcaggtcacatttctcttgaagattaagagaaccaggaaaggcttcagacttctgaacccacatcctaagccaaaccccaaaaacaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase)
- pleckstrin homology domain containing, family B (evectins) member 1
- VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
- sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1