GCAT-glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) Gene View larger

GCAT-glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GCAT-glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GCAT-glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014457
Product type: DNA & cDNA
Ncbi symbol: GCAT
Origin species: Human
Product name: GCAT-glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) Gene
Size: 2ug
Accessions: BC014457
Gene id: 23464
Gene description: glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase)
Synonyms: KBL; 2-amino-3-ketobutyrate coenzyme A ligase, mitochondrial; 2-amino-3-ketobutyrate-CoA ligase; AKB ligase; aminoacetone synthase; glycine acetyltransferase; glycine C-acetyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggcctgggaacgcctggcgcgccgcactcttctgggtgccccgcggccgccgcgcacagtcagcgctggcccagctgcgtggcattctggagggggagctggaaggcatctgcggagctggcacttggaagagtgagcgggtcatcacgtcccgtcaggggccgcacatccgcgtggacggcgtctccggaggaatccttaacttctgtgccaacaactacctgggcctgagcagccaccctgaggtgatccaggcaggtctgcaggctctggaggagtttggagctggcctcagctctgtccgctttatctgtggaacccagagcatccacaagaatctagaagcaaaaatagcccgcttccaccagcgggaggatgccatcctctatcccagctgttatgacgccaacgccggcctctttgaggccctgctgaccccagaggacgcagtcctgtcggacgagctgaaccatgcctccatcatcgacggcatccggctgtgcaaggcccacaagtaccgctatcgccacctggacatggccgacctagaagccaagctgcaggaggcccagaagcatcggctgcgcctggtggccactgatggggccttttccatggatggcgacatcgcacccctgcaggagatctgctgcctcgcctctagatatggtgccctggtcttcatggatgaatgccatgccactggcttcctggggcccacaggacggggcacagatgagctgctgggtgtgatggaccaggtcaccatcatcaactccaccctggggaaggccctgggtggagcatcagggggctacacgacagggcctgggcccctggtgtccctgctgcggcagcgcgcccggccatacctcttctccaacagtctgccacctgctgtcgttggctgcgcctccaaggccctagatctgctgatggggagtaacaccattgtccagtctatggctgccaagacccagaggttccgtagtaagatggaagctgctggcttcactatctcgggagccagtcaccccatctgccctgtgatgctgggtgatgcccggctggcctctcgcatggcggatgacatgctgaagagaggcatctttgtcatcgggttcagctaccccgtggtccccaagggcaaggcctggatccgggtacagatctcagcagtgcatagcgaggaagacattgaccgctgcgtggaggccttcgtggaagtggggcgactgcacggggcactgccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pleckstrin homology domain containing, family B (evectins) member 1
- VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa
- sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1
- phosphatidylinositol-specific phospholipase C, X domain containing 1

Buy GCAT-glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase) Gene now

Add to cart