PPP2CB-protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform Gene View larger

PPP2CB-protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform Gene

PTXBC012022

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP2CB-protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPP2CB-protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012022
Product type: DNA & cDNA
Ncbi symbol: PPP2CB
Origin species: Human
Product name: PPP2CB-protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform Gene
Size: 2ug
Accessions: BC012022
Gene id: 5516
Gene description: protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform
Synonyms: PP2Abeta; PP2CB; serine/threonine-protein phosphatase 2A catalytic subunit beta isoform; PP2A-beta; protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform; protein phosphatase 2, catalytic subunit, beta isoform; protein phosphatase 2, catalytic subunit, beta isozyme; protein phosphatase 2A catalytic subunit, beta isoform; protein phosphatase type 2A catalytic subunit; serine/threonine protein phosphatase 2A, catalytic subunit, beta isoform; testicular tissue protein Li 146; protein phosphatase 2 catalytic subunit beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgacaaggcgttcaccaaggagctggaccagtgggtcgagcagctgaacgagtgtaagcagctgaacgagaaccaagtgcggacgctgtgcgagaaggcaaaggaaattttaacaaaagaatcaaatgtgcaagaggttcgttgccctgttactgtctgtggagatgtgcatggtcaatttcatgatcttatggaactctttagaattggtggaaaatcaccggatacaaactacttattcatgggtgactatgtagacagaggatattattcagtggagactgtgactcttcttgtagcattaaaggtgcgttatccagaacgcattacaatattgagaggaaatcacgaaagccgacaaattacccaagtatatggcttttatgatgaatgtctgcgaaagtatgggaatgccaacgtttggaaatattttacagatctctttgattatcttccacttacagctttagtagatggacagatattctgcctccatggtggcctctctccatccatagacacactggatcatataagagccctggatcgtttacaggaagttccacatgagggcccaatgtgtgatctgttatggtcagatccagatgatcgtggtggatggggtatttcaccacgtggtgctggctacacatttggacaagacatttctgaaacctttaaccatgccaatggtctcacactggtttctcgtgcccaccagcttgtaatggagggatacaattggtgtcatgatcggaatgtggttaccattttcagtgcacccaattactgttatcgttgtgggaaccaggctgctatcatggaattagatgacactttaaaatattccttccttcaatttgacccagcgcctcgtcgtggtgagcctcatgttacacggcgcaccccagactacttcctataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
- glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase)
- pleckstrin homology domain containing, family B (evectins) member 1
- VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa

Buy PPP2CB-protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform Gene now

Add to cart