Login to display prices
Login to display prices
KLRD1-killer cell lectin-like receptor subfamily D, member 1 Gene View larger

KLRD1-killer cell lectin-like receptor subfamily D, member 1 Gene

PTXBC028009

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KLRD1-killer cell lectin-like receptor subfamily D, member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KLRD1-killer cell lectin-like receptor subfamily D, member 1 Gene

Proteogenix catalog: PTXBC028009
Ncbi symbol: KLRD1
Product name: KLRD1-killer cell lectin-like receptor subfamily D, member 1 Gene
Size: 2ug
Accessions: BC028009
Gene id: 3824
Gene description: killer cell lectin-like receptor subfamily D, member 1
Synonyms: natural killer cells antigen CD94; CD94 antigen; KP43; NK cell receptor; killer cell lectin-like receptor subfamily D, member 1; killer cell lectin like receptor D1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagtgtttaagaccactctgtggaggttaatttctgggaccttagggataatatgcctttcgttgatggctacgttgggaattttgttgaaaaattcttttactaaactgagtattgagccagcatttactccaggacccaacatagaactccagaaagactctgactgctgttcttgccaagaaaaatgggttgggtaccggtgcaactgttacttcatttccagtgaacagaaaacttggaacgaaagtcggcatctctgtgcttctcagaaatccagcctgcttcagcttcaaaacacagatgaactggattttatgagctccagtcaacaattttactggattggactctcttacagtgaggagcacaccgcctggttgtgggagaatggctctgcactctcccagtatctatttccatcatttgaaacttttaatacaaagaactgcatagcgtataatccaaatggaaatgctttagatgaatcctgtgaagataaaaatcgttatatctgtaagcaacagctcatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: