Login to display prices
Login to display prices
DPYD-dihydropyrimidine dehydrogenase Gene View larger

DPYD-dihydropyrimidine dehydrogenase Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DPYD-dihydropyrimidine dehydrogenase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DPYD-dihydropyrimidine dehydrogenase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008379
Product type: DNA & cDNA
Ncbi symbol: DPYD
Origin species: Human
Product name: DPYD-dihydropyrimidine dehydrogenase Gene
Size: 2ug
Accessions: BC008379
Gene id: 1806
Gene description: dihydropyrimidine dehydrogenase
Synonyms: DHP; DHPDHASE; DPD; dihydropyrimidine dehydrogenase [NADP(+)]; dihydrothymine dehydrogenase; dihydrouracil dehydrogenase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccctgtgctcagtaaggactcggcggacatcgagagtatcctggctttaaatcctcgaacacaaactcatgcaactctgtgttccacttcggccaagaaattagacaagaaacattggaaaagaaatcctgataagaactgctttaattgtgagaagctggagaataattttgatgacatcaagcacacgactcttggtgagcgaggagctctccgagaagcaatgagatgcctgaaatgtgcagatgccccgtgtcagaagagctgtccaactaatcttgatattaaatcattcatcacaagtattgcaaacaagaactattatggagctgctaagatgatattttctgacaacccacttggtctgacttgtggaatggtatgtccaacctctgatctttgtgtaggtggatgcaatttatatgccactgaagagggacccattaatattggtggattgcagcaatttgctactgagactttgatcctggctttctctttaatgaatcatttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S4, X-linked
- glutathione S-transferase mu 4
- ATP/GTP binding protein-like 2
- deafness, autosomal dominant 5