MFAP5-microfibrillar associated protein 5 Gene View larger

MFAP5-microfibrillar associated protein 5 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MFAP5-microfibrillar associated protein 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MFAP5-microfibrillar associated protein 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005901
Product type: DNA & cDNA
Ncbi symbol: MFAP5
Origin species: Human
Product name: MFAP5-microfibrillar associated protein 5 Gene
Size: 2ug
Accessions: BC005901
Gene id: 8076
Gene description: microfibrillar associated protein 5
Synonyms: THE1A-MFAP5; AAT9; MAGP-2; MAGP2; MFAP-5; MP25; microfibrillar-associated protein 5; microfibril-associated glycoprotein-2; microfibrillar associated protein 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgctcttgggacccaaggtgctgctgtttcttgctgcattcatcatcacctctgactggatacccctgggggtcaatagtcaacgaggagacgatgtgactcaagcgactccagaaacattcacagaagatcctaatctggtgaatgatcccgctacagatgaaacagttttggctgttttggctgatattgcaccttccacagatgacttggcctccctcagtgaaaaaaataccactgcagagtgctgggatgagaaatttacctgcacaaggctctactctgtgcatcggccggttaaacaatgcattcatcagttatgcttcaccagtttacgacgtatgtacatcgtcaacaaggagatctgctctcgtcttgtctgtaaggaacacgaagctatgaaagatgagctttgccgtcagatggctggtctgccccctaggagactccgtcgctccaattacttccgacttcctccctgtgaaaatgtggatttgcagagacccaatggtctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - organic solute transporter alpha
- abhydrolase domain containing 14B
- RAB39B, member RAS oncogene family
- RAB11A, member RAS oncogene family

Buy MFAP5-microfibrillar associated protein 5 Gene now

Add to cart