OSTalpha-organic solute transporter alpha Gene View larger

OSTalpha-organic solute transporter alpha Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OSTalpha-organic solute transporter alpha Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about OSTalpha-organic solute transporter alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029606
Product type: DNA & cDNA
Ncbi symbol: OSTalpha
Origin species: Human
Product name: OSTalpha-organic solute transporter alpha Gene
Size: 2ug
Accessions: BC029606
Gene id: 200931
Gene description: organic solute transporter alpha
Synonyms: OSTalpha; OSTA; organic solute transporter subunit alpha; OST-alpha; organic solute transporter alpha; organic solute transporter, alpha subunit; solute carrier family 51 subunit alpha; solute carrier family 51 alpha subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggaaggctttggggggaaggaggcagtgctgaggacgctgagggacaccccgatgatggtccacacaggcccctgctgctgctgctgcccctgctgtccacggctgctgctcaccaggaagaagcttcagctgctgatgttgggccctttccaatacgccttcttgaagataacgctgaccctggtgggcctgtttctcatccccgacggcatctatgacccagcagacatttctgaggggagcacagctctatggatcaacactttcctcggcgtgtccacactgctggctctctggaccctgggcatcatttcccgtcaagccaggctacacctgggtgagcagaacatgggagccaaatttgctctgttccaggttctcctcatcctgactgccctacagccctccatcttctcagtcttggccaacggtgggcagattgcttgttcgcctccctattcctctaaaaccaggtctcaagtgatgaattgccacctcctcatactggagacttttctaatgactgtgctgacacgaatgtactaccgaaggaaagaccacaaggttgggtatgaaactttctcttctccagacctggacttgaacctcaaagcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - abhydrolase domain containing 14B
- RAB39B, member RAS oncogene family
- RAB11A, member RAS oncogene family
- D-2-hydroxyglutarate dehydrogenase

Buy OSTalpha-organic solute transporter alpha Gene now

Add to cart