C9orf7-chromosome 9 open reading frame 7 Gene View larger

C9orf7-chromosome 9 open reading frame 7 Gene

PTXBC030558

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf7-chromosome 9 open reading frame 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf7-chromosome 9 open reading frame 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030558
Product type: DNA & cDNA
Ncbi symbol: C9orf7
Origin species: Human
Product name: C9orf7-chromosome 9 open reading frame 7 Gene
Size: 2ug
Accessions: BC030558
Gene id: 11094
Gene description: chromosome 9 open reading frame 7
Synonyms: C9orf7; D9S2135; FLOWER; calcium channel flower homolog; calcium channel flower domain-containing protein 1; calcium channel flower domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcagctcaggtggggcgcccggggcgtccgccagctctgcgccgcccgcgcaggaagagggcatgacgtggtggtaccgctggctgtgtcgcctgtctggggtgctgggggcagtctcttgcgcgatctctggcctcttcaactgcatcaccatccaccctctgaacatcgcggccggcgtgtggatgatcatgaatgccttcatcttgttgctgtgtgaggcgcccttctgctgccagttcatcgagtttgcaaacacagtggcggagaaggtggaccggctgcgctcctggcagaaggctgtcttctactgcgggatggcggtcgttcccatcgtcatcagcctgaccctgaccacgctgctgggcaacgccatcgcctttgctacgggggtgctgtacggactctctgctctgggcaaaaagggcgatgcgatctcctatgccaggatccagcagcagaggcagcaggcggatgaggagaagctcgcggagaccctggagggggagctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine rich repeat containing 68
- gap junction protein, beta 2, 26kDa
- chromosome 1 open reading frame 2
- cysteine-rich secretory protein 2

Buy C9orf7-chromosome 9 open reading frame 7 Gene now

Add to cart