Login to display prices
Login to display prices
C9orf7-chromosome 9 open reading frame 7 Gene View larger

C9orf7-chromosome 9 open reading frame 7 Gene

PTXBC030558

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf7-chromosome 9 open reading frame 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf7-chromosome 9 open reading frame 7 Gene

Proteogenix catalog: PTXBC030558
Ncbi symbol: C9orf7
Product name: C9orf7-chromosome 9 open reading frame 7 Gene
Size: 2ug
Accessions: BC030558
Gene id: 11094
Gene description: chromosome 9 open reading frame 7
Synonyms: C9orf7; D9S2135; FLOWER; calcium channel flower homolog; calcium channel flower domain-containing protein 1; calcium channel flower domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcagctcaggtggggcgcccggggcgtccgccagctctgcgccgcccgcgcaggaagagggcatgacgtggtggtaccgctggctgtgtcgcctgtctggggtgctgggggcagtctcttgcgcgatctctggcctcttcaactgcatcaccatccaccctctgaacatcgcggccggcgtgtggatgatcatgaatgccttcatcttgttgctgtgtgaggcgcccttctgctgccagttcatcgagtttgcaaacacagtggcggagaaggtggaccggctgcgctcctggcagaaggctgtcttctactgcgggatggcggtcgttcccatcgtcatcagcctgaccctgaccacgctgctgggcaacgccatcgcctttgctacgggggtgctgtacggactctctgctctgggcaaaaagggcgatgcgatctcctatgccaggatccagcagcagaggcagcaggcggatgaggagaagctcgcggagaccctggagggggagctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: