Login to display prices
Login to display prices
BTG1-B-cell translocation gene 1, anti-proliferative Gene View larger

BTG1-B-cell translocation gene 1, anti-proliferative Gene

PTXBC016759

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BTG1-B-cell translocation gene 1, anti-proliferative Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BTG1-B-cell translocation gene 1, anti-proliferative Gene

Proteogenix catalog: PTXBC016759
Ncbi symbol: BTG1
Product name: BTG1-B-cell translocation gene 1, anti-proliferative Gene
Size: 2ug
Accessions: BC016759
Gene id: 694
Gene description: B-cell translocation gene 1, anti-proliferative
Synonyms: protein BTG1; APRO2; B-cell translocation gene 1 protein; B-cell translocation gene 1, anti-proliferative; BTG anti-proliferation factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcatcccttctacacccgggccgccaccatgataggcgagatcgccgccgccgtgtccttcatctccaagtttctccgcaccaaggggctcacgagcgagcgacagctgcagaccttcagccagagcctgcaggagctgctggcagaacattataaacatcactggttcccagaaaagccatgcaagggatcgggttaccgttgtattcgcatcaaccataaaatggatcctctgattggacaggcagcacagcggattggactgagcagtcaggagctgttcaggcttctcccaagtgaactcacactctgggttgacccctatgaagtgtcctacagaattggagaggatggctccatctgtgtgctgtatgaagcctcaccagcaggaggtagcactcaaaacagcaccaacgtgcaaatggtagacagccgaatcagctgtaaggaggaacttctcttgggcagaacgagcccttccaaaaactacaatatgatgactgtatcaggttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice