Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ALKBH6-alkB, alkylation repair homolog 6 (E. coli) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ALKBH6-alkB, alkylation repair homolog 6 (E. coli) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007601 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ALKBH6 |
| Origin species: | Human |
| Product name: | ALKBH6-alkB, alkylation repair homolog 6 (E. coli) Gene |
| Size: | 2ug |
| Accessions: | BC007601 |
| Gene id: | 84964 |
| Gene description: | alkB, alkylation repair homolog 6 (E. coli) |
| Synonyms: | ABH6; alpha-ketoglutarate-dependent dioxygenase alkB homolog 6; alkB, alkylation repair homolog 6; alkylated DNA repair protein alkB homolog 6; alkylation repair homolog 6; alkB homolog 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttcctgagcggctgcccccatggctccagcgctacgtggacaaagtgtcaaacctcagcctctttggaggcctcccagctaaccatgtcctcgtgaaccagtatctgcctggggagggcatcatgccccacgaggacggaccactgtactacccgactgtcagcaccatcagcctgggctcccacaccgtgctggacttctacgagccgcggcggccagaggacgatgaccctacagaacagcctcggcctccgccccggcccaccacctcgctactgctggaaccgcgcagcctgctggtgctccgcggccccgcctacacgcgtcttctccacggcatcgccgccgcccgcgtagacgcgctggacgccgcctcctcgccgcccaatgcggcagcctgcccgtcggcgcggccgggagcctgcctggtgcgcggcacccgggtctcgctgaccatccgccgcgtgccccgcgtgctgcgcgccggcctcctgctgggcaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - golgi reassembly stacking protein 1, 65kDa - coagulation factor VIII, procoagulant component - DnaJ (Hsp40) homolog, subfamily B, member 9 - alkB, alkylation repair homolog 8 (E. coli) |