REG1A-regenerating islet-derived 1 alpha Gene View larger

REG1A-regenerating islet-derived 1 alpha Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of REG1A-regenerating islet-derived 1 alpha Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about REG1A-regenerating islet-derived 1 alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005350
Product type: DNA & cDNA
Ncbi symbol: REG1A
Origin species: Human
Product name: REG1A-regenerating islet-derived 1 alpha Gene
Size: 2ug
Accessions: BC005350
Gene id: 5967
Gene description: regenerating islet-derived 1 alpha
Synonyms: ICRF; P19; PSP; PSPS; PSPS1; PTP; REG; lithostathine-1-alpha; REG-1-alpha; islet cells regeneration factor; islet of langerhans regenerating protein; pancreatic stone protein, secretory; pancreatic thread protein; protein-X; regenerating islet-derived protein 1-alpha; regenerating protein I alpha; regenerating family member 1 alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcagaccagctcatacttcatgctgatctcctgcctgatgtttctgtctcagagccaaggccaagaggcccagacagagttgccccaggcccggatcagctgcccagaaggcaccaatgcctatcgctcctactgctactactttaatgaagaccgtgagacctgggttgatgcagatctctattgccagaacatgaattcgggcaacctggtgtctgtgctcacccaggccgagggtgcctttgtggcctcactgattaaggagagtggcactgatgacttcaatgtctggattggcctccatgaccccaaaaagaaccgccgctggcactggagcagtgggtccctggtctcctacaagtcctggggcattggagccccaagcagtgttaatcctggctactgtgtgagcctgacctcaagcacaggattccagaaatggaaggatgtgccttgtgaagacaagttctcctttgtctgcaagttcaaaaactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 7
- leucine rich repeat containing 68
- gap junction protein, beta 2, 26kDa
- chromosome 1 open reading frame 2

Buy REG1A-regenerating islet-derived 1 alpha Gene now

Add to cart