Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of REG1A-regenerating islet-derived 1 alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about REG1A-regenerating islet-derived 1 alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005350 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | REG1A |
| Origin species: | Human |
| Product name: | REG1A-regenerating islet-derived 1 alpha Gene |
| Size: | 2ug |
| Accessions: | BC005350 |
| Gene id: | 5967 |
| Gene description: | regenerating islet-derived 1 alpha |
| Synonyms: | ICRF; P19; PSP; PSPS; PSPS1; PTP; REG; lithostathine-1-alpha; REG-1-alpha; islet cells regeneration factor; islet of langerhans regenerating protein; pancreatic stone protein, secretory; pancreatic thread protein; protein-X; regenerating islet-derived protein 1-alpha; regenerating protein I alpha; regenerating family member 1 alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcagaccagctcatacttcatgctgatctcctgcctgatgtttctgtctcagagccaaggccaagaggcccagacagagttgccccaggcccggatcagctgcccagaaggcaccaatgcctatcgctcctactgctactactttaatgaagaccgtgagacctgggttgatgcagatctctattgccagaacatgaattcgggcaacctggtgtctgtgctcacccaggccgagggtgcctttgtggcctcactgattaaggagagtggcactgatgacttcaatgtctggattggcctccatgaccccaaaaagaaccgccgctggcactggagcagtgggtccctggtctcctacaagtcctggggcattggagccccaagcagtgttaatcctggctactgtgtgagcctgacctcaagcacaggattccagaaatggaaggatgtgccttgtgaagacaagttctcctttgtctgcaagttcaaaaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 9 open reading frame 7 - leucine rich repeat containing 68 - gap junction protein, beta 2, 26kDa - chromosome 1 open reading frame 2 |