Login to display prices
Login to display prices
ZC3H3-zinc finger CCCH-type containing 3 Gene View larger

ZC3H3-zinc finger CCCH-type containing 3 Gene

PTXBC034435

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZC3H3-zinc finger CCCH-type containing 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZC3H3-zinc finger CCCH-type containing 3 Gene

Proteogenix catalog: PTXBC034435
Ncbi symbol: ZC3H3
Product name: ZC3H3-zinc finger CCCH-type containing 3 Gene
Size: 2ug
Accessions: BC034435
Gene id: 23144
Gene description: zinc finger CCCH-type containing 3
Synonyms: ZC3HDC3; zinc finger CCCH domain-containing protein 3; smad-interacting CPSF-like factor; zinc finger CCCH-type domain containing 3; zinc finger CCCH-type containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagccaggaggagagcccacaggtgctaaagagagcagtaccctgatggagtcccttgcaggccggctggatcctgcaggcagctgtagccgttccctggccagccgggcagtgcagcgcagcctggccatcatccggcaggcgcggcagcgcagggagaagaggaaggagtactgcatgtactacaaccgcttcggcaggtgcaaccgtggcgagcgctgcccctacatccacgatcccgagaaggtggccgtgtgcaccaggtttgtccggggcacctgcaagaaaacggatgggacctgccccttctcccaccatgtgtccaaggagaagatgccggtgtgctcctacttcctgaagggcatctgcagcaacagcaactgtccctatagccacgtgtacgtgtcccgcaaggccgaggtctgcagcgacttcctcaaaggctactgccccctgggtgcaaagtgcaagaagaaacacacgctgctgtgccccgactttgcccgcaggggggcgtgtccccgcggcgcccagtgccagctgctccaccgtacccagaaacgccacagtcggcgggcagccacgtcccccgccccagggcccagcgacgcaaccgccaggagcagggtctcggccagccacgggcccaggaagccttcagcatcccagcgccccaccaggcagacgcccagctcggctgccctcactgcggctgccgtggctgcacctccccactgcccaggggggtcagcctctccctcatcctcgaaggcttcctcctcctcctcctcctcctcatcccctcccgcttccttggaccacgaggcaccatctctccaggaggctgccttagcagcagcgtgctccaacaggctctgcaagctgccttccttcatctccctgcagtcctcgccgagcccaggagcccagcccagggtccgggcccctagggcccccctcaccaaggactcagggaagcctctgcacatcaaaccacgtctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: