ACTR8-ARP8 actin-related protein 8 homolog (yeast) Gene View larger

ACTR8-ARP8 actin-related protein 8 homolog (yeast) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACTR8-ARP8 actin-related protein 8 homolog (yeast) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACTR8-ARP8 actin-related protein 8 homolog (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032744
Product type: DNA & cDNA
Ncbi symbol: ACTR8
Origin species: Human
Product name: ACTR8-ARP8 actin-related protein 8 homolog (yeast) Gene
Size: 2ug
Accessions: BC032744
Gene id: 93973
Gene description: ARP8 actin-related protein 8 homolog (yeast)
Synonyms: ARP8; INO80N; hArp8; actin-related protein 8; INO80 complex subunit N; ARP8 actin-related protein 8 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatactaatgaagatgggtttttcagggattgtggtccatcaggagtctgtgtgtgccacctatggaagtggcttaagcagcacgtgtattgtagacgttggggaccagaagacaagtgtatgctgtgtggaggatggggtgtctcatcggaatactcgcatcttttcctggaatcaggacatctctgggcttcaggaccatgagtttcagattcgacatcctgattctcctgccctgctttaccagtttcgattaggagatgaaaaactgcaggctccaatggctttgttttaccccgcaacttttggaattgttggacagaaaatgacgactttgcagcacagatctcagggcgatcctgaggatcctcacgatgaacattacctgctggccacacagagcaaacaagaacagtctgcaaaagctactgctgaccgaaagtctgcatccaaacctattggatttgaaggggatcttcgtggccagtcctctgatcttccagaaagactccattcccaggaggtagatttggggtctgcacagggagatggcctgatggccggcaacgattccgaggaggccctcactgcactgatgtccaggaagactgccatctcgctgtttgaagggaaagccctgggcctggataaagccatcctccatagcatagactgctgttcatctgacgacaccaaaaagaagatgtacagctccatcctagtggtgggaggtggtttgatgtttcataaagctcaagaatttctgcagcacagaattctcaacaaaatgccaccatccttcaggcgaattattgaaaatgtggatgtgatcacaaggcctaaggacatggacccccggctgattgcatggaaaggaggggcagtgttggcttgtttggatacaacacaggaactgtggatttatcagcgagagtggcagcgctttggtgtccgcatgttacgagagcgggctgcgtttgtgtggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - alkB, alkylation repair homolog 6 (E. coli)
- golgi reassembly stacking protein 1, 65kDa
- coagulation factor VIII, procoagulant component
- DnaJ (Hsp40) homolog, subfamily B, member 9

Buy ACTR8-ARP8 actin-related protein 8 homolog (yeast) Gene now

Add to cart