Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 494,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 494,00 €
Data sheet of FKBP6-FK506 binding protein 6, 36kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FKBP6-FK506 binding protein 6, 36kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036817 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FKBP6 |
| Origin species: | Human |
| Product name: | FKBP6-FK506 binding protein 6, 36kDa Gene |
| Size: | 2ug |
| Accessions: | BC036817 |
| Gene id: | 8468 |
| Gene description: | FK506 binding protein 6, 36kDa |
| Synonyms: | peptidyl-prolyl cis-trans isomerase FKBP6; inactive PPIase FKBP6; PPIase FKBP6; inactive peptidyl-prolyl cis-trans isomerase FKBP6; FKBP36; 36 kDa FKBP; FK506 binding protein 6, 36kDa; immunophilin FKBP36; rotamase; FK506 binding protein 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggggaagcgcgttaaaccagggagtcctggaaggggacgacgcccccggccagtccctgtacgagcggttaagtcagaggatgctggacatctcgggggaccggggcgtgctgaaggacgtcatccgagaaggagctggagacctagtggcgcctgatgcttcggtgctagtgaaatactcgggatacctggaacacatggacagacccttcgattctaattactttaggaaaactcctcggctaatgaaacttggagaggatattacactgtggggcatggagctgggccttctgagcatgcggagaggagagctggccaggtttctgttcaaaccgaactacgcctatggaacgctgggctgccctcccttgatccccccaaacaccactgtcctgtttgagattgagctgcttgacttcctggactgtgctgagtcagacaagttttgtgctctctcagctgagcagcaagaccaatttccacttcagaaggtcctgaaagtggcagctacggaacgggagtttggcaactaccttttccgccagaatcgtttctatgatgccaaagtgagatataaaagggccctgttgcttctgcgccggcgatcagcaccccctgaagagcagcacctggtggaggccgccaagcttcctgttctcctgaacctgtcctttacatacctgaagctagaccgacccaccatagccctgtgctatggagagcaggctttgatcattgaccaaaagaatgccaaggccctcttcaggtgtggacaggcttgtcttctcctgactgagtatcaaaaggcccgggattttctagttcgagcccagaaggagcaacccttcaatcatgacatcaataatgagctgaagaaactggctagctgttacagggactatgtggataaagagaaagaaatgtggcaccgcatgttcgcgccctgtggcgatggttctacagcaggagaaagttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dihydropyrimidine dehydrogenase - ribosomal protein S4, X-linked - glutathione S-transferase mu 4 - ATP/GTP binding protein-like 2 |