RPRD1B-regulation of nuclear pre-mRNA domain containing 1B Gene View larger

RPRD1B-regulation of nuclear pre-mRNA domain containing 1B Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPRD1B-regulation of nuclear pre-mRNA domain containing 1B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RPRD1B-regulation of nuclear pre-mRNA domain containing 1B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033629
Product type: DNA & cDNA
Ncbi symbol: RPRD1B
Origin species: Human
Product name: RPRD1B-regulation of nuclear pre-mRNA domain containing 1B Gene
Size: 2ug
Accessions: BC033629
Gene id: 58490
Gene description: regulation of nuclear pre-mRNA domain containing 1B
Synonyms: C20orf77; CREPT; NET60; dJ1057B20.2; regulation of nuclear pre-mRNA domain-containing protein 1B; cell-cycle related and expression-elevated protein in tumor; regulation of nuclear pre-mRNA domain containing 1B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctccttctctgagtcggcgctggagaagaagctctcggagctgagcaactctcagcacagcgtgcagaccctgtccctttggctcatccaccaccgcaagcacgcgggacccatcgtctccgtgtggcaccgcgagctccgcaaagccaaatcaaatagaaagcttacttttctgtatttagcgaatgatgtcatccaaaacagtaaaaggaaaggacctgaattcactagagaatttgaatctgtccttgtggatgctttttctcatgttgccagagaggcagatgaaggctgtaaaaaacctttagaaagattgctgaacatctggcaagaacgaagtgtgtatggcggcgagttcatacagcagctgaagctgtctatggaggactccaagagccctccccccaaagcaacagaagagaagaaatctctgaaacgaacttttcagcaaattcaggaggaggaggatgacgactaccctggcagctactctcctcaggatccttctgcaggacccctcttgactgaggaactaatcaaagctttgcaggatctggaaaatgccgcatcaggggatgctactgtccgacagaaaattgcttctctgccccaggaagtgcaagatgtttctctattggaaaaaataacagacaaagaggcagctgaacgtctttcaaaaacagtagatgaagcatgtctgttactagcagaatataacgggcgcctggcagcagaactggaggaccgtcgccagctggctcggatgttggtggagtatacccagaatcagaaagatgttttgtcggagaaggagaaaaaactagaggaatacaaacagaagcttgcacgagtaacccaggtccgcaaggaactgaaatcccatattcagagcttgccagacctctcactgctgcccaacgtcacagggggcttagcccccctgccctctgctggggacctgttttcaactgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TIA1 cytotoxic granule-associated RNA binding protein
- ChaC, cation transport regulator homolog 1 (E. coli)
- nucleotide binding protein 2 (MinD homolog, E. coli)
- cleavage and polyadenylation specific factor 3-like

Buy RPRD1B-regulation of nuclear pre-mRNA domain containing 1B Gene now

Add to cart