Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RPRD1B-regulation of nuclear pre-mRNA domain containing 1B Gene
PTXBC033629
New product
Data sheet of RPRD1B-regulation of nuclear pre-mRNA domain containing 1B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPRD1B-regulation of nuclear pre-mRNA domain containing 1B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033629 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPRD1B |
| Origin species: | Human |
| Product name: | RPRD1B-regulation of nuclear pre-mRNA domain containing 1B Gene |
| Size: | 2ug |
| Accessions: | BC033629 |
| Gene id: | 58490 |
| Gene description: | regulation of nuclear pre-mRNA domain containing 1B |
| Synonyms: | C20orf77; CREPT; NET60; dJ1057B20.2; regulation of nuclear pre-mRNA domain-containing protein 1B; cell-cycle related and expression-elevated protein in tumor; regulation of nuclear pre-mRNA domain containing 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcctccttctctgagtcggcgctggagaagaagctctcggagctgagcaactctcagcacagcgtgcagaccctgtccctttggctcatccaccaccgcaagcacgcgggacccatcgtctccgtgtggcaccgcgagctccgcaaagccaaatcaaatagaaagcttacttttctgtatttagcgaatgatgtcatccaaaacagtaaaaggaaaggacctgaattcactagagaatttgaatctgtccttgtggatgctttttctcatgttgccagagaggcagatgaaggctgtaaaaaacctttagaaagattgctgaacatctggcaagaacgaagtgtgtatggcggcgagttcatacagcagctgaagctgtctatggaggactccaagagccctccccccaaagcaacagaagagaagaaatctctgaaacgaacttttcagcaaattcaggaggaggaggatgacgactaccctggcagctactctcctcaggatccttctgcaggacccctcttgactgaggaactaatcaaagctttgcaggatctggaaaatgccgcatcaggggatgctactgtccgacagaaaattgcttctctgccccaggaagtgcaagatgtttctctattggaaaaaataacagacaaagaggcagctgaacgtctttcaaaaacagtagatgaagcatgtctgttactagcagaatataacgggcgcctggcagcagaactggaggaccgtcgccagctggctcggatgttggtggagtatacccagaatcagaaagatgttttgtcggagaaggagaaaaaactagaggaatacaaacagaagcttgcacgagtaacccaggtccgcaaggaactgaaatcccatattcagagcttgccagacctctcactgctgcccaacgtcacagggggcttagcccccctgccctctgctggggacctgttttcaactgactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TIA1 cytotoxic granule-associated RNA binding protein - ChaC, cation transport regulator homolog 1 (E. coli) - nucleotide binding protein 2 (MinD homolog, E. coli) - cleavage and polyadenylation specific factor 3-like |