GPR171-G protein-coupled receptor 171 Gene View larger

GPR171-G protein-coupled receptor 171 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR171-G protein-coupled receptor 171 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GPR171-G protein-coupled receptor 171 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036815
Product type: DNA & cDNA
Ncbi symbol: GPR171
Origin species: Human
Product name: GPR171-G protein-coupled receptor 171 Gene
Size: 2ug
Accessions: BC036815
Gene id: 29909
Gene description: G protein-coupled receptor 171
Synonyms: H963; F730001G15Rik; G-protein coupled receptor H963; platelet activating receptor homolog; G protein-coupled receptor 171
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaaacagttcgttcttctgcccagtttataaagatctggagccattcacgtattttttttatttagttttccttgttggaattattggaagttgttttgcaacctgggcttttatacagaagaatacgaatcacaggtgtgtgagcatctacttaattaatttgcttacagccgatttcctgcttactctggcattaccagtgaaaattgttgttgacttgggtgtggcaccttggaagctgaagatattccactgccaagtaacagcctgcctcatctatatcaatatgtatttatcaattatcttcttagcatttgtcagcattgaccgctgtcttcagctgacacacagctgcaagatctaccgaatacaagaacccggatttgccaaaatgatatcaaccgttgtgtggctaatggtccttcttataatggtgccaaatatgatgattcccatcaaagacatcaaggaaaagtcaaatgtgggttgtatggagtttaaaaaggaatttggaagaaattggcatttgctgacaaatttcatatgtgtagcaatatttttaaatttctcagccatcattttaatatccaattgccttgtaattcgacagctctacagaaacaaagataatgaaaattacccaaatgtgaaaaaggctctcatcaacatacttttagtgaccacgggctacatcatatgctttgttccttaccacattgtccgaatcccgtataccctcagccagacagaagtcataactgattgctcaaccaggatttcactcttcaaagccaaagaggctacactgctcctggctgtgtcgaacctgtgctttgatcctgtcctgtactatcacctctcaaaagcattccgctcaaaggtcactgagacttttgcctcacctaaagagaccaaggctcagaaagaaaaattaagatgtgaaaataatgcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - synovial sarcoma, X breakpoint 4
- phospholipase A2, group XIIA
- signal-regulatory protein delta
- tripartite motif-containing 11

Buy GPR171-G protein-coupled receptor 171 Gene now

Add to cart