PTXBC005325
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005325 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SSX4 |
| Origin species: | Human |
| Product name: | SSX4-synovial sarcoma, X breakpoint 4 Gene |
| Size: | 2ug |
| Accessions: | BC005325 |
| Gene id: | 6759 |
| Gene description: | synovial sarcoma, X breakpoint 4 |
| Synonyms: | protein SSX4; CT5.4; cancer/testis antigen 5.4; synovial sarcoma, X breakpoint 4; SSX family member 4 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacggagacgacgcctttgcaaggagacccagggatgatgctcaaatatcagagaagttacgaaaggccttcgatgatattgccaaatacttctctaagaaagagtgggaaaagatgaaatcctcggagaaaatcgtctatgtgtatatgaagctaaactatgaggtcatgactaaactaggtttcaaggtcaccctcccacctttcatgcgtagtaaacgggctgcagacttccacgggaatgattttggtaacgatcgaaaccacaggaatcaggttgaacgtcctcagatgactttcggcagcctccagagaatcttcccgaagatcatgcccaagaagccagcagaggaagaaaatggtttgaaggaagtgccagaggcatctggcccacaaaatgatgggaaacagctgtgccccccgggaaatccaagtaccttggagaagatcaacaagacatctggacccaaaagggggaaacatgcctggacccacagactgcgtgagagaaagcagctggtggtttatgaagagatcagcgaccctgaggaagatgacgagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - phospholipase A2, group XIIA - signal-regulatory protein delta - tripartite motif-containing 11 - zinc finger, AN1-type domain 6 |