PLA2G12A-phospholipase A2, group XIIA Gene View larger

PLA2G12A-phospholipase A2, group XIIA Gene

PTXBC017218

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PLA2G12A-phospholipase A2, group XIIA Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PLA2G12A-phospholipase A2, group XIIA Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017218
Product type: DNA & cDNA
Ncbi symbol: PLA2G12A
Origin species: Human
Product name: PLA2G12A-phospholipase A2, group XIIA Gene
Size: 2ug
Accessions: BC017218
Gene id: 81579
Gene description: phospholipase A2, group XIIA
Synonyms: GXII; PLA2G12; ROSSY; group XIIA secretory phospholipase A2; GXII sPLA2; group XII secreted phospholipase A2; group XIIA secreted phospholipase A2; phosphatidylcholine 2-acylhydrolase 12A; phospholipase A2, group XII; sPLA2-XII; phospholipase A2 group XIIA
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctgctctcgcgccccgcgctcaccctcctgctcctcctcatggccgctgttgtcaggtgccaggagcaggcccagaccaccgactggagagccaccctgaagaccatccggaacggcgttcataagatagacacgtacctgaacgccgccttggacctcctgggaggcgaggacggtctctgccagtataaatgcagtgacggatctaagcctttcccacgttatggttataaaccctccccaccgaatggatgtggctctccactgtttggtgttcatcttaacattggtatcccttccctgacaaagtgttgcaaccaacacgacaggtgctatgagacctgtggcaaaagcaagaatgactgtgatgaagaattccagtattgcctctccaagatctgccgagatgtacagaaaacactaggactaactcagcatgttcaggcatgtgaaacaacagtggagctcttgtttgacagtgttatacatttaggttgtaaaccatatctggacagccaacgagccgcatgcaggtgtcattatgaagaaaaaactgatctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - signal-regulatory protein delta
- tripartite motif-containing 11
- zinc finger, AN1-type domain 6
- zinc finger protein 22 (KOX 15)

Buy PLA2G12A-phospholipase A2, group XIIA Gene now

Add to cart