Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PLA2G12A-phospholipase A2, group XIIA Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLA2G12A-phospholipase A2, group XIIA Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017218 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLA2G12A |
| Origin species: | Human |
| Product name: | PLA2G12A-phospholipase A2, group XIIA Gene |
| Size: | 2ug |
| Accessions: | BC017218 |
| Gene id: | 81579 |
| Gene description: | phospholipase A2, group XIIA |
| Synonyms: | GXII; PLA2G12; ROSSY; group XIIA secretory phospholipase A2; GXII sPLA2; group XII secreted phospholipase A2; group XIIA secreted phospholipase A2; phosphatidylcholine 2-acylhydrolase 12A; phospholipase A2, group XII; sPLA2-XII; phospholipase A2 group XIIA |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccctgctctcgcgccccgcgctcaccctcctgctcctcctcatggccgctgttgtcaggtgccaggagcaggcccagaccaccgactggagagccaccctgaagaccatccggaacggcgttcataagatagacacgtacctgaacgccgccttggacctcctgggaggcgaggacggtctctgccagtataaatgcagtgacggatctaagcctttcccacgttatggttataaaccctccccaccgaatggatgtggctctccactgtttggtgttcatcttaacattggtatcccttccctgacaaagtgttgcaaccaacacgacaggtgctatgagacctgtggcaaaagcaagaatgactgtgatgaagaattccagtattgcctctccaagatctgccgagatgtacagaaaacactaggactaactcagcatgttcaggcatgtgaaacaacagtggagctcttgtttgacagtgttatacatttaggttgtaaaccatatctggacagccaacgagccgcatgcaggtgtcattatgaagaaaaaactgatctttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signal-regulatory protein delta - tripartite motif-containing 11 - zinc finger, AN1-type domain 6 - zinc finger protein 22 (KOX 15) |