Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SIRPD-signal-regulatory protein delta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SIRPD-signal-regulatory protein delta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033502 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SIRPD |
| Origin species: | Human |
| Product name: | SIRPD-signal-regulatory protein delta Gene |
| Size: | 2ug |
| Accessions: | BC033502 |
| Gene id: | 128646 |
| Gene description: | signal-regulatory protein delta |
| Synonyms: | PTPNS1L2; dJ576H24.4; signal-regulatory protein delta; SIRP-delta; protein tyrosine phosphatase, non-receptor type substrate 1-like 2; signal regulatory protein delta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccatccctgcctccccactccacccacctctgccttccttactgctgtatctgctgcttgaactggcaggagtcacacatgtgttccatgtgcaacaaacggagatgtcacagactgtatcaactggggagtcaatcatcttgagttgcagcgtacccgataccttaccaaatggacctgtcttgtggttcaagggaacagggccaaaccggaaattaatctacaatttcaaacaaggtaactttcccagagtaaaagagattggagacaccaccaagcctggcaacacagacttttccacccgcatccgtgaaatctctcttgctgatgctggcacctattactgcgtgaagttcataaaaggaagagctatcaaggagtaccaatcaggtcggggcactcaggtgtttgttactgagcagaatccaagacctcccaagaacagacctgcaggcagagcaggctccagggcccaccatgatgcccatacctgcctctcggccctgcctgagagaaacagcacaaactatttcgtccaaccctgctgctgcctccggctgctgggactcacaggcttgctgtcaaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tripartite motif-containing 11 - zinc finger, AN1-type domain 6 - zinc finger protein 22 (KOX 15) - chromatin modifying protein 4B |