TRIM11-tripartite motif-containing 11 Gene View larger

TRIM11-tripartite motif-containing 11 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRIM11-tripartite motif-containing 11 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRIM11-tripartite motif-containing 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011629
Product type: DNA & cDNA
Ncbi symbol: TRIM11
Origin species: Human
Product name: TRIM11-tripartite motif-containing 11 Gene
Size: 2ug
Accessions: BC011629
Gene id: 81559
Gene description: tripartite motif-containing 11
Synonyms: E3 ubiquitin-protein ligase TRIM11; BIA1; RNF92; RING finger protein 92; tripartite motif-containing protein 11; tripartite motif containing 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctgaggaccgtgtgcagggtcccgggactggtagagacactgcggaggtttcgaggggacgtgaccttggacccggacaccgccaaccctgagctgatcctgtctgaagacaggcggagcgtgcagcggggggacctacggcaggccctgccggacagcccagagcgctttgaccccggcccctgcgtgctgggccaggagcgcttcacctcaggccgccactactgggaggtggaggttggggaccgcaccagctgggccctgggggtgtgcagggagaacgtgaacaggaaggagaagggcgagctgtccgcgggcaacggcttctggatcctggtcttcctggggagctattacaattcctcggaacgggccttggctccactccgggacccacccaggcgcgtggggatctttctggactacgaggctggacatctctctttctacagtgccaccgatgggtcactgctattcatctttcccgagatccccttctcggggacgctgcggcccctcttctcacccctgtccagcagcccgaccccgatgactatctgccggccgaaaggtgggtccggggacaccctggctccccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, AN1-type domain 6
- zinc finger protein 22 (KOX 15)
- chromatin modifying protein 4B
- hydroxyacylglutathione hydrolase

Buy TRIM11-tripartite motif-containing 11 Gene now

Add to cart