Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CHMP4B-chromatin modifying protein 4B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHMP4B-chromatin modifying protein 4B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033859 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHMP4B |
| Origin species: | Human |
| Product name: | CHMP4B-chromatin modifying protein 4B Gene |
| Size: | 2ug |
| Accessions: | BC033859 |
| Gene id: | 128866 |
| Gene description: | chromatin modifying protein 4B |
| Synonyms: | C20orf178; CHMP4A; CTPP3; CTRCT31; SNF7; SNF7-2; Shax1; VPS32B; Vps32-2; dJ553F4.4; charged multivesicular body protein 4b; SNF7 homolog associated with Alix 1; Snf7 homologue associated with Alix 1; chromatin modifying protein 4B; chromatin-modifying protein 4b; hSnf7-2; hVps32-2; vacuolar protein-sorting-associated protein 32-2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggtgttcgggaagctgttcggggctggagggggtaaggccggcaagggcggcccgaccccccaggaggccatccagcggctgcgggacacggaagagatgttaagcaagaaacaggagttcctggagaagaaaatcgagcaggagctgacggccgccaagaagcacggcaccaaaaacaagcgcgcggccctccaggcactgaagcgtaagaagaggtatgagaagcagctggcgcagatcgacggcacattatcaaccatcgagttccagcgggaggccctggagaatgccaacaccaacaccgaggtgctcaagaacatgggctatgccgccaaggccatgaaggcggcccatgacaacatggacatcgataaagttgatgagttaatgcaggacattgctgaccagcaagaacttgcagaggagatttcaacagcaatttcgaaacctgtagggtttggagaagagtttgacgaggatgagctcatggcggaattagaagaactagaacaggaggaactagacaagaatttgctggaaatcagtggacccgaaacagtccctctaccaaatgttccctctatagccctaccatcaaaacccgccaagaagaaagaagaggaggacgacgacatgaaggaattggagaactgggctggatccatgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hydroxyacylglutathione hydrolase - testis-specific serine kinase 3 - aquaporin 1 (Colton blood group) - Fc fragment of IgA, receptor for |