Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of AQP1-aquaporin 1 (Colton blood group) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AQP1-aquaporin 1 (Colton blood group) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022486 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AQP1 |
| Origin species: | Human |
| Product name: | AQP1-aquaporin 1 (Colton blood group) Gene |
| Size: | 2ug |
| Accessions: | BC022486 |
| Gene id: | 358 |
| Gene description: | aquaporin 1 (Colton blood group) |
| Synonyms: | AQP-CHIP; CHIP28; aquaporin-1; aquaporin 1 (channel-forming integral protein, 28kDa, CO blood group); aquaporin 1, Colton blood group antigen; aquaporin-CHIP; channel-like integral membrane protein, 28-kDa; urine water channel; water channel protein for red blood cells and kidney proximal tubule; aquaporin 1 (Colton blood group) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagcgagttcaagaagaagctcttctggagggcagtggtggccgagttcctggccacgaccctctttgtcttcatcagcatcggttctgccctgggcttcaaatacccggtggggaacaaccagacgacggtccaggacaacgtgaaggtgtcgctggccttcgggctgagcatcgccacgctggcgcagagtgtgggccacatcagcggcgcccacctcaacccggctgtcacactggggctgctgctcagctgccagatcagcatcttccgtgccctcatgtacatcatcgcccagtgcgtgggggccatcgtcgccaccgccatcctctcaggcatcacctcctccctgactgggaactcgcttggccgcaatgacctggctgatggtgtgaactcgggccagggcctgggcatcgagatcatcgggaccctccagctggtgctatgcgtgctggctactaccgaccggaggcgccgtgaccttggtggctcagccccccttgccatcggcctctctgtagcccttggacacctcctggctattgactacactggctgtgggattaaccctgctcggtcctttggctccgcggtgatcacacacaacttcagcaaccactggattttctgggtggggccattcatcgggggagccctggctgtactcatctacgacttcatcctggccccacgcagcagtgacctcacagaccgcgtgaaggtgtggaccagcggccaggtggaggagtatgacctggatgccgacgacatcaactccagggtggagatgaagcccaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Fc fragment of IgA, receptor for - Rhox homeobox family, member 2 - ubiquitin specific peptidase 45 - calponin 1, basic, smooth muscle |