Login to display prices
Login to display prices
AQP1-aquaporin 1 (Colton blood group) Gene View larger

AQP1-aquaporin 1 (Colton blood group) Gene

PTXBC022486

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AQP1-aquaporin 1 (Colton blood group) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AQP1-aquaporin 1 (Colton blood group) Gene

Proteogenix catalog: PTXBC022486
Ncbi symbol: AQP1
Product name: AQP1-aquaporin 1 (Colton blood group) Gene
Size: 2ug
Accessions: BC022486
Gene id: 358
Gene description: aquaporin 1 (Colton blood group)
Synonyms: AQP-CHIP; CHIP28; aquaporin-1; aquaporin 1 (channel-forming integral protein, 28kDa, CO blood group); aquaporin 1, Colton blood group antigen; aquaporin-CHIP; channel-like integral membrane protein, 28-kDa; urine water channel; water channel protein for red blood cells and kidney proximal tubule; aquaporin 1 (Colton blood group)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagcgagttcaagaagaagctcttctggagggcagtggtggccgagttcctggccacgaccctctttgtcttcatcagcatcggttctgccctgggcttcaaatacccggtggggaacaaccagacgacggtccaggacaacgtgaaggtgtcgctggccttcgggctgagcatcgccacgctggcgcagagtgtgggccacatcagcggcgcccacctcaacccggctgtcacactggggctgctgctcagctgccagatcagcatcttccgtgccctcatgtacatcatcgcccagtgcgtgggggccatcgtcgccaccgccatcctctcaggcatcacctcctccctgactgggaactcgcttggccgcaatgacctggctgatggtgtgaactcgggccagggcctgggcatcgagatcatcgggaccctccagctggtgctatgcgtgctggctactaccgaccggaggcgccgtgaccttggtggctcagccccccttgccatcggcctctctgtagcccttggacacctcctggctattgactacactggctgtgggattaaccctgctcggtcctttggctccgcggtgatcacacacaacttcagcaaccactggattttctgggtggggccattcatcgggggagccctggctgtactcatctacgacttcatcctggccccacgcagcagtgacctcacagaccgcgtgaaggtgtggaccagcggccaggtggaggagtatgacctggatgccgacgacatcaactccagggtggagatgaagcccaaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: