USP45-ubiquitin specific peptidase 45 Gene View larger

USP45-ubiquitin specific peptidase 45 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of USP45-ubiquitin specific peptidase 45 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about USP45-ubiquitin specific peptidase 45 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005991
Product type: DNA & cDNA
Ncbi symbol: USP45
Origin species: Human
Product name: USP45-ubiquitin specific peptidase 45 Gene
Size: 2ug
Accessions: BC005991
Gene id: 85015
Gene description: ubiquitin specific peptidase 45
Synonyms: ubiquitin carboxyl-terminal hydrolase 45; deubiquitinating enzyme 45; ubiquitin specific protease 45; ubiquitin thioesterase 45; ubiquitin thiolesterase 45; ubiquitin-specific-processing protease 45; ubiquitin specific peptidase 45
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgggtgaaagatccaactaaagctttacctgagaaagccaaaagaagtaaaaggcctactgtacctcatgatgaagactcttcagatgatattgctgtaggtttaacttgccaacatgtaagtcatgctatcagcgtgaatcatgtaaagagagcaatagctgagaatctgtggtcagtttgctcagaatgtttagaagaaagaagattctatgatgggcagctagtacttacttctgatatttggttgtgcctcaagtgtggcttccagggatgtggtaaaaactcagaaagccaacattcattgaagcactttaagagttccagaacagagccccattgtattataattaatctgagcacatggattatatggtgttatgaatgtgatgaaaaattatcaacgcattgtaataagaaggttttggctcagatagttgattttctccagaaacatgcttctaaaacacaaacaagtgcattttctagaatcatgaaactttgtgaagaaaaatgtgaaacagatgaaatacagaagggaggaaaatgcagaaatttatctgtaagaggaattacaaatttaggaaatacttgcttttttaatgcagtcatgcagaacttggcacagacttatactcttactgatctgatgaatgagatcaaagaaagtagtacaaaactcaagatttttccttcctcagactctcagctggacccattggtggtggaactttcaaggcctggaccactgacctcagccttgttcctgtttcttcacagcatgaaggagactgaaaaaggaccactttctcctaaagttctttttaatcagctttgtcagaagcgggtgcatctacatttaatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calponin 1, basic, smooth muscle
- aspartoacylase (Canavan disease)
- melanoma antigen family A, 11
- CUB domain containing protein 1

Buy USP45-ubiquitin specific peptidase 45 Gene now

Add to cart