Login to display prices
Login to display prices
USP45-ubiquitin specific peptidase 45 Gene View larger

USP45-ubiquitin specific peptidase 45 Gene

PTXBC005991

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of USP45-ubiquitin specific peptidase 45 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about USP45-ubiquitin specific peptidase 45 Gene

Proteogenix catalog: PTXBC005991
Ncbi symbol: USP45
Product name: USP45-ubiquitin specific peptidase 45 Gene
Size: 2ug
Accessions: BC005991
Gene id: 85015
Gene description: ubiquitin specific peptidase 45
Synonyms: ubiquitin carboxyl-terminal hydrolase 45; deubiquitinating enzyme 45; ubiquitin specific protease 45; ubiquitin thioesterase 45; ubiquitin thiolesterase 45; ubiquitin-specific-processing protease 45; ubiquitin specific peptidase 45
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgggtgaaagatccaactaaagctttacctgagaaagccaaaagaagtaaaaggcctactgtacctcatgatgaagactcttcagatgatattgctgtaggtttaacttgccaacatgtaagtcatgctatcagcgtgaatcatgtaaagagagcaatagctgagaatctgtggtcagtttgctcagaatgtttagaagaaagaagattctatgatgggcagctagtacttacttctgatatttggttgtgcctcaagtgtggcttccagggatgtggtaaaaactcagaaagccaacattcattgaagcactttaagagttccagaacagagccccattgtattataattaatctgagcacatggattatatggtgttatgaatgtgatgaaaaattatcaacgcattgtaataagaaggttttggctcagatagttgattttctccagaaacatgcttctaaaacacaaacaagtgcattttctagaatcatgaaactttgtgaagaaaaatgtgaaacagatgaaatacagaagggaggaaaatgcagaaatttatctgtaagaggaattacaaatttaggaaatacttgcttttttaatgcagtcatgcagaacttggcacagacttatactcttactgatctgatgaatgagatcaaagaaagtagtacaaaactcaagatttttccttcctcagactctcagctggacccattggtggtggaactttcaaggcctggaccactgacctcagccttgttcctgtttcttcacagcatgaaggagactgaaaaaggaccactttctcctaaagttctttttaatcagctttgtcagaagcgggtgcatctacatttaatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: