CDCP1-CUB domain containing protein 1 Gene View larger

CDCP1-CUB domain containing protein 1 Gene

PTXBC021099

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDCP1-CUB domain containing protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CDCP1-CUB domain containing protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021099
Product type: DNA & cDNA
Ncbi symbol: CDCP1
Origin species: Human
Product name: CDCP1-CUB domain containing protein 1 Gene
Size: 2ug
Accessions: BC021099
Gene id: 64866
Gene description: CUB domain containing protein 1
Synonyms: CD318; SIMA135; TRASK; CUB domain-containing protein 1; membrane glycoprotein gp140; subtractive immunization M plus HEp3-associated 135 kDa protein; transmembrane and associated with src kinases; CUB domain containing protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccggcctgaactgcggggtctctatcgcactgctaggggttctgctgctgggtgcggcgcgcctgccgcgcggggcagaagcttttgagattgctctgccacgagaaagcaacattacagttctcataaagctggggaccccgactctgctggcaaaaccctgttacatcgtcatttctaaaagacatataaccatgttgtccatcaagtctggagaaagaatagtctttacctttagctgccagagtcctgagaatcactttgtcatagagatccagaaaaatattgactgtatgtcaggcccatgtccttttggggaggttcagcttcagccctcgacatcgttgttgcctaccctcaacagaactttcatctgggatgtcaaagctcataagagcatcggtttagagctgcagttttccatccctcgcctgaggcagatcggtccgggtgagagctgcccagacggagtcactcactccatcagcggccgaatcgatgccaccgtggtcaggatcggaaccttctgcagcaatggcactgtgtcccggatcaagatgcaagaaggagtgaaaatggccttacacctcccatggttccaccccagaaatgtctccggcttcagcattgcaaaccgctcatctataaaacgtctgtgcatcatcgagtctgtgtttgagggtgaaggctcagcaaccctgatgtctgccaactacccagaaggcttccctgaggatgagctcatgacgtggcagtttgtcgttcctgcacacctgcgggccagcgtctccttcctcaacttcaacctctccaactgtgagaggaaggaggagcgggttgaatactacatcccgggctccaccaccaaccccgaggtgttcaagctggaggacaagcagcctgggaacatggcggggaacttcaacctctctctgcaaggctgtgaccaagatgcccaaagtccagggatcctccggctgcagttccaagttttggtccaacatccacaaaatgaaagcagtgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - abhydrolase domain containing 5
- nephroblastoma overexpressed gene
- ubiquitin specific peptidase 18
- phosphatidylserine decarboxylase

Buy CDCP1-CUB domain containing protein 1 Gene now

Add to cart