ABHD5-abhydrolase domain containing 5 Gene View larger

ABHD5-abhydrolase domain containing 5 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ABHD5-abhydrolase domain containing 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ABHD5-abhydrolase domain containing 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021958
Product type: DNA & cDNA
Ncbi symbol: ABHD5
Origin species: Human
Product name: ABHD5-abhydrolase domain containing 5 Gene
Size: 2ug
Accessions: BC021958
Gene id: 51099
Gene description: abhydrolase domain containing 5
Synonyms: 1-acylglycerol-3-phosphate O-acyltransferase ABHD5; CDS; CGI58; IECN2; NCIE2; abhydrolase domain-containing protein 5; lipid droplet-binding protein CGI-58; truncated abhydrolase domain-containing protein 5; abhydrolase domain containing 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggaggaggaggaggtggactctgccgacaccggagagaggtcaggatggctaactggttggctccccacatggtgccctacgtctatatcacaccttaaagaagctgaagagaagatgttaaaatgtgtgccttgcacatacaaaaaagaacctgttcgtatatctaatggaaataaaatatggacactgaagttctctcataatatttcaaataagactccacttgtccttctccatggttttggaggaggtcttgggctctgggcactgaattttggagatctttgcaccaacagacctgtctatgcttttgacctattgggttttggacgaagtagtagacccaggtttgacagtgatgcagaagaagtggagaatcagtttgtggaatccattgaagagtggagatgtgccctaggattggacaaaatgatcttgcttgggcacaacctaggtggattcttggctgctgcttactcgctgaagtacccatcaagggttaatcatctcattttagtggagccttggggtttccctgaacgaccagaccttgctgatcaagacagaccaattccagtttggatcagagccttgggagcagcattgactccctttaaccctttagctggcctaaggattgcaggaccctttggtttaagtctagtgcagcgtttaaggcctgatttcaaacgaaagtattcttcaatgttcgaagacgatactgtgacagaatacatctaccactgtaatgtgcagactccaagtggtgagacagctttcaagaatatgactattccttatggatgggcaaaaaggccaatgctccagcgaattggtaaaatgcaccctgacattccagtttcagtgatctttggcgcccgatcctgcatagatggcaattctggcaccagcatccagtccttacgaccacattcatatgtgaagacaatagctattcttggggcaggacattatgtatatgcagatcaaccagaagaattcaaccagaaagtaaaggagatctgcgacactgtggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nephroblastoma overexpressed gene
- ubiquitin specific peptidase 18
- phosphatidylserine decarboxylase
- macrophage erythroblast attacher

Buy ABHD5-abhydrolase domain containing 5 Gene now

Add to cart