CNN1-calponin 1, basic, smooth muscle Gene View larger

CNN1-calponin 1, basic, smooth muscle Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CNN1-calponin 1, basic, smooth muscle Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CNN1-calponin 1, basic, smooth muscle Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022015
Product type: DNA & cDNA
Ncbi symbol: CNN1
Origin species: Human
Product name: CNN1-calponin 1, basic, smooth muscle Gene
Size: 2ug
Accessions: BC022015
Gene id: 1264
Gene description: calponin 1, basic, smooth muscle
Synonyms: HEL-S-14; SMCC; Sm-Calp; calponin-1; basic calponin; calponin 1, basic, smooth muscle; calponin H1, smooth muscle; calponins, basic; epididymis secretory protein Li 14; calponin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctctgctcacttcaaccgaggccctgcctacgggctgtcagccgaggttaagaacaagctggcccagaagtatgaccaccagcgggagcaggagctgagagagtggatcgagggggtgacaggccgtcgcatcggcaacaacttcatggacggcctcaaagatggcatcattctttgcgaattcatcaataagctgcagccaggctccgtgaagaagatcaatgagtcaacccaaaattggcaccagctggagaacatcggcaacttcatcaaggccatcaccaagtatggggtgaagccccacgacatttttgaggccaacgacctgtttgagaacaccaaccatacacaggtgcagtccaccctcctggctttggccagcatggcgaagacgaaaggaaacaaggtgaacgtgggagtgaagtacgcagagaagcaggagcggaaattcgagccggggaagctaagagaagggcggaacatcattgggctgcagatgggcaccaacaagtttgccagccagcagggcatgacggcctatggcacccggcgccacctctacgaccccaagctgggcacagaccagcctctggaccaggcgaccatcagcctgcagatgggcaccaacaaaggagccagccaggctggcatgactgcgccagggaccaagcggcagatcttcgagccggggctgggcatggagcactgcgacacgctcaatgtcagcctgcagatgggcagcaacaagggcgcctcgcagcggggcatgacggtgtatgggctgccacgccaggtctacgaccccaagtactgtctgactcccgagtacccagagctgggtgagcccgcccacaaccaccacgcacacaactactacaattccgcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aspartoacylase (Canavan disease)
- melanoma antigen family A, 11
- CUB domain containing protein 1
- abhydrolase domain containing 5

Buy CNN1-calponin 1, basic, smooth muscle Gene now

Add to cart