Login to display prices
Login to display prices
CNN1-calponin 1, basic, smooth muscle Gene View larger

CNN1-calponin 1, basic, smooth muscle Gene

PTXBC022015

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CNN1-calponin 1, basic, smooth muscle Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CNN1-calponin 1, basic, smooth muscle Gene

Proteogenix catalog: PTXBC022015
Ncbi symbol: CNN1
Product name: CNN1-calponin 1, basic, smooth muscle Gene
Size: 2ug
Accessions: BC022015
Gene id: 1264
Gene description: calponin 1, basic, smooth muscle
Synonyms: HEL-S-14; SMCC; Sm-Calp; calponin-1; basic calponin; calponin 1, basic, smooth muscle; calponin H1, smooth muscle; calponins, basic; epididymis secretory protein Li 14; calponin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctctgctcacttcaaccgaggccctgcctacgggctgtcagccgaggttaagaacaagctggcccagaagtatgaccaccagcgggagcaggagctgagagagtggatcgagggggtgacaggccgtcgcatcggcaacaacttcatggacggcctcaaagatggcatcattctttgcgaattcatcaataagctgcagccaggctccgtgaagaagatcaatgagtcaacccaaaattggcaccagctggagaacatcggcaacttcatcaaggccatcaccaagtatggggtgaagccccacgacatttttgaggccaacgacctgtttgagaacaccaaccatacacaggtgcagtccaccctcctggctttggccagcatggcgaagacgaaaggaaacaaggtgaacgtgggagtgaagtacgcagagaagcaggagcggaaattcgagccggggaagctaagagaagggcggaacatcattgggctgcagatgggcaccaacaagtttgccagccagcagggcatgacggcctatggcacccggcgccacctctacgaccccaagctgggcacagaccagcctctggaccaggcgaccatcagcctgcagatgggcaccaacaaaggagccagccaggctggcatgactgcgccagggaccaagcggcagatcttcgagccggggctgggcatggagcactgcgacacgctcaatgtcagcctgcagatgggcagcaacaagggcgcctcgcagcggggcatgacggtgtatgggctgccacgccaggtctacgaccccaagtactgtctgactcccgagtacccagagctgggtgagcccgcccacaaccaccacgcacacaactactacaattccgcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: