ASPA-aspartoacylase (Canavan disease) Gene View larger

ASPA-aspartoacylase (Canavan disease) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ASPA-aspartoacylase (Canavan disease) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ASPA-aspartoacylase (Canavan disease) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029128
Product type: DNA & cDNA
Ncbi symbol: ASPA
Origin species: Human
Product name: ASPA-aspartoacylase (Canavan disease) Gene
Size: 2ug
Accessions: BC029128
Gene id: 443
Gene description: aspartoacylase (Canavan disease)
Synonyms: ACY2; ASP; ACY-2; aminoacylase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacttcttgtcacattgctgaagaacatatacaaaaggttgctatctttggaggaacccatgggaatgagctaaccggagtatttctggttaagcattggctagagaatggcgctgagattcagagaacagggctggaggtaaaaccatttattactaaccccagagcagtgaagaagtgtaccagatatattgactgtgacctgaatcgcatttttgaccttgaaaatcttggcaaaaaaatgtcagaagatttgccatatgaagtgagaagggctcaagaaataaatcatttatttggtccaaaagacagtgaagattcctatgacattatttttgaccttcacaacaccacctctaacatggggtgcactcttattcttgaggattccaggaataactttttaattcagatgtttcattacattaagacttctctggctccactaccctgctacgtttatctgattgagcatccttccctcaaatatgcgaccactcgttccatagccaagtatcctgtgggtatagaagttggtcctcagcctcaaggggttctgagagctgatatcttggatcaaatgagaaaaatgattaaacatgctcttgattttatacatcatttcaatgaaggaaaagaatttcctccctgcgccattgaggtctataaaattatagagaaagttgattacccccgggatgaaaatggagaaattgctgctatcatccatcctaatctgcaggatcaagactggaaaccactgcatcctggggatcccatgtttttaactcttgatgggaagacgatcccactgggcggagactgtaccgtgtaccccgtgtttgtgaatgaggccgcatattacgaaaagaaagaagcttttgcaaagacaactaaactaacgctcaatgcaaaaagtattcgctgctgtttacattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melanoma antigen family A, 11
- CUB domain containing protein 1
- abhydrolase domain containing 5
- nephroblastoma overexpressed gene

Buy ASPA-aspartoacylase (Canavan disease) Gene now

Add to cart