Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TSSK3-testis-specific serine kinase 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TSSK3-testis-specific serine kinase 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035354 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TSSK3 |
| Origin species: | Human |
| Product name: | TSSK3-testis-specific serine kinase 3 Gene |
| Size: | 2ug |
| Accessions: | BC035354 |
| Gene id: | 81629 |
| Gene description: | testis-specific serine kinase 3 |
| Synonyms: | SPOGA3; STK22C; STK22D; TSK3; testis-specific serine/threonine-protein kinase 3; TSK-3; TSSK-3; serine/threonine-protein kinase 22C; spermiogenesis associated 3; testis-specific kinase 3; testis-specific serine/threonine kinase 22C; testis specific serine kinase 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggactttctgctctccaatgggtaccagctgggcaagaccattggggaagggacctactcaaaagtcaaagaagcattttccaaaaaacaccaaagaaaagtggcaattaaagttatagacaagatgggagggccagaagagtttatccagagattcctccctcgggagctccaaatcgtccgtaccctggaccacaagaacatcatccaggtgtatgagatgctggagtctgccgacgggaaaatctgcctggtgatggagctcgctgagggaggggatgtctttgactgcgtgctgaatggggggccactgcctgaaagccgggccaaggccctcttccgtcagatggttgaggccatccgctactgccatggctgtggtgtggcccaccgggacctcaaatgtgagaacgccttgttgcagggcttcaacctgaagctgactgactttggctttgccaaggtgttgcccaagtcacaccgggagctgagccagaccttctgcggcagtacagcctatgctgcccccgaggtgctgcagggcattccccacgatagcaaaaaaggtgatgtctggagcatgggtgtggtcctgtatgtcatgctctgtgccagcctaccttttgacgacacagacatccccaagatgctgtggcagcagcagaagggggtgtccttccccactcatctgagcatctcggccgattgccaggacctgctcaagaggctcctggaacccgatatgatcctccggccttcaattgaagaagttagttggcatccatggctagcaagcacttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aquaporin 1 (Colton blood group) - Fc fragment of IgA, receptor for - Rhox homeobox family, member 2 - ubiquitin specific peptidase 45 |