Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ZNF22-zinc finger protein 22 (KOX 15) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZNF22-zinc finger protein 22 (KOX 15) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010642 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZNF22 |
| Origin species: | Human |
| Product name: | ZNF22-zinc finger protein 22 (KOX 15) Gene |
| Size: | 2ug |
| Accessions: | BC010642 |
| Gene id: | 7570 |
| Gene description: | zinc finger protein 22 (KOX 15) |
| Synonyms: | HKR-T1; KOX15; ZNF422; Zfp422; zinc finger protein 22; krox-26 protein; zinc finger protein 22 (KOX 15); zinc finger protein KOX15; zinc finger protein Krox-26 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggttagcaaagcctaaagcgggtatttctcggagctcaagccaaggaaaggcctatgagaacaagcgcaaaacaggccggcagcggcagaagtggggcatgactattcgatttgactcaagcttcagtagactcagaagaagcttggatgacaaaccctataaatgtactgaatgtgaaaagagtttcagtcagagttcaactctttttcaacaccagaagatccatactggaaagaaatcccataaatgtgctgattgtgggaaaagtttctttcagagttctaatctcattcagcatcgacggatccatacgggggaaaagccctacaaatgtgatgagtgtggagaaagcttcaaacagagctcaaatctcattcagcaccagagaattcatactggagaaaaaccctatcagtgtgatgagtgtggccggtgtttcagccagagctcccaccttattcaacatcagagaacccacactggggagaaaccctaccagtgcagtgaatgtggcaaatgtttcagtcagagctctcatctgaggcagcacatgaaggtgcataaagaagagaagcctcgtaaaacccggggcaaaaatatcagggtgaagactcacttaccctcttggaaagctggtacaggaaggaagtctgtggctggtctccgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromatin modifying protein 4B - hydroxyacylglutathione hydrolase - testis-specific serine kinase 3 - aquaporin 1 (Colton blood group) |