NDUFA12-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 Gene View larger

NDUFA12-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 Gene

PTXBC005936

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFA12-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFA12-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005936
Product type: DNA & cDNA
Ncbi symbol: NDUFA12
Origin species: Human
Product name: NDUFA12-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 Gene
Size: 2ug
Accessions: BC005936
Gene id: 55967
Gene description: NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
Synonyms: B17.2; DAP13; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 12; 13 kDa differentiation-associated protein; CI-B17.2; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12; NADH-ubiquinone oxidoreductase subunit B17.2; complex I B17.2 subunit; NADH:ubiquinone oxidoreductase subunit A12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagttagtgcaggtcctgaaacgcgggctgcagcagatcaccggccacggcggtctccgaggctatctacgggtttttttcaggacaaatgatgcgaaggttggtacattagtgggggaagacaaatatggaaacaaatactatgaagacaacaagcaattttttggccgtcaccgatgggttgtatatactactgaaatgaatggcaaaaacacattctgggatgtggatggaagcatggtgcctcctgaatggcatcgttggcttcacagtatgactgatgatcctccaacaacaaaaccacttgctgctcgtaaattcatttggacgaaccataaattcaacgtgactggcaccccagaacaatatgtaccttattctaccactagaaagaagattcaggagtggatcccaccttcaacaccttacaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - polymerase (DNA-directed), delta interacting protein 3
- Fc fragment of IgG, low affinity IIIa, receptor (CD16a)
- haloacid dehalogenase-like hydrolase domain containing 2
- major histocompatibility complex, class II, DR beta 5

Buy NDUFA12-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 Gene now

Add to cart