Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFA12-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 Gene
PTXBC005936
New product
Data sheet of NDUFA12-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFA12-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005936 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFA12 |
| Origin species: | Human |
| Product name: | NDUFA12-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 Gene |
| Size: | 2ug |
| Accessions: | BC005936 |
| Gene id: | 55967 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 |
| Synonyms: | B17.2; DAP13; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 12; 13 kDa differentiation-associated protein; CI-B17.2; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12; NADH-ubiquinone oxidoreductase subunit B17.2; complex I B17.2 subunit; NADH:ubiquinone oxidoreductase subunit A12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagttagtgcaggtcctgaaacgcgggctgcagcagatcaccggccacggcggtctccgaggctatctacgggtttttttcaggacaaatgatgcgaaggttggtacattagtgggggaagacaaatatggaaacaaatactatgaagacaacaagcaattttttggccgtcaccgatgggttgtatatactactgaaatgaatggcaaaaacacattctgggatgtggatggaagcatggtgcctcctgaatggcatcgttggcttcacagtatgactgatgatcctccaacaacaaaaccacttgctgctcgtaaattcatttggacgaaccataaattcaacgtgactggcaccccagaacaatatgtaccttattctaccactagaaagaagattcaggagtggatcccaccttcaacaccttacaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polymerase (DNA-directed), delta interacting protein 3 - Fc fragment of IgG, low affinity IIIa, receptor (CD16a) - haloacid dehalogenase-like hydrolase domain containing 2 - major histocompatibility complex, class II, DR beta 5 |