Login to display prices
Login to display prices
POLDIP3-polymerase (DNA-directed), delta interacting protein 3 Gene View larger

POLDIP3-polymerase (DNA-directed), delta interacting protein 3 Gene

PTXBC019643

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLDIP3-polymerase (DNA-directed), delta interacting protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POLDIP3-polymerase (DNA-directed), delta interacting protein 3 Gene

Proteogenix catalog: PTXBC019643
Ncbi symbol: POLDIP3
Product name: POLDIP3-polymerase (DNA-directed), delta interacting protein 3 Gene
Size: 2ug
Accessions: BC019643
Gene id: 84271
Gene description: polymerase (DNA-directed), delta interacting protein 3
Synonyms: PDIP46; polymerase delta-interacting protein 3; 46 kDa DNA polymerase delta interaction protein; RNA-binding protein P46; S6K1 Aly/REF-like target; polymerase (DNA) delta interacting protein 3; polymerase (DNA-directed), delta interacting protein 3; DNA polymerase delta interacting protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggacatctccctggacgaactcatcaggaagcgcggggcggcggcgaaaggacggcttaatgccagaccgggagttggaggtgtccgatctcgagttgggatccagcaaggccttctcagccagtcaacacgcacagccaccttccagcagagatttgatgcccggcagaagattggcctctcagatgcccggctcaaactgggagtcaaggatgcccgggagaagcttttgcagaaagatgcccgatttcgaatcaaagggaaagtgcaggatgccagagagatgttgaactctcgcaagcagcagaccacggtgccccagaagccccgccaggttgctgatgcccgggagaagatcagcttgaagaggagttcccctgctgccttcataaacccacccattgggacagtgacccctgctctgaagctcaccaaaaccatccagaatttatatgacctggatgaagatgatgatggtatagcttccgttcctactaaacagatgaagtttgcagcctcaggcggctttctccaccacatggctgggctaagcagttccaagctttccatgtccaaggccctccctctcaccaaagtggttcagaatgatgcatacacagctcctgctctcccttcctctattcgaacaaaagccctcccggttctcacctcgcctggcacttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: