Cart 4 Product Products 460,34 € (empty)
-
1 x EIF1AX-euk...113,40 € -
1 x STRADA-STE...113,40 € -
-
1 x WBP1-WW...121,50 €
No products
To be determined Shipping
460,34 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 460,34 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 460,34 €
View larger 
POLDIP3-polymerase (DNA-directed), delta interacting protein 3 Gene
PTXBC019643
New product
Data sheet of POLDIP3-polymerase (DNA-directed), delta interacting protein 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLDIP3-polymerase (DNA-directed), delta interacting protein 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019643 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLDIP3 |
| Origin species: | Human |
| Product name: | POLDIP3-polymerase (DNA-directed), delta interacting protein 3 Gene |
| Size: | 2ug |
| Accessions: | BC019643 |
| Gene id: | 84271 |
| Gene description: | polymerase (DNA-directed), delta interacting protein 3 |
| Synonyms: | PDIP46; polymerase delta-interacting protein 3; 46 kDa DNA polymerase delta interaction protein; RNA-binding protein P46; S6K1 Aly/REF-like target; polymerase (DNA) delta interacting protein 3; polymerase (DNA-directed), delta interacting protein 3; DNA polymerase delta interacting protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggacatctccctggacgaactcatcaggaagcgcggggcggcggcgaaaggacggcttaatgccagaccgggagttggaggtgtccgatctcgagttgggatccagcaaggccttctcagccagtcaacacgcacagccaccttccagcagagatttgatgcccggcagaagattggcctctcagatgcccggctcaaactgggagtcaaggatgcccgggagaagcttttgcagaaagatgcccgatttcgaatcaaagggaaagtgcaggatgccagagagatgttgaactctcgcaagcagcagaccacggtgccccagaagccccgccaggttgctgatgcccgggagaagatcagcttgaagaggagttcccctgctgccttcataaacccacccattgggacagtgacccctgctctgaagctcaccaaaaccatccagaatttatatgacctggatgaagatgatgatggtatagcttccgttcctactaaacagatgaagtttgcagcctcaggcggctttctccaccacatggctgggctaagcagttccaagctttccatgtccaaggccctccctctcaccaaagtggttcagaatgatgcatacacagctcctgctctcccttcctctattcgaacaaaagccctcccggttctcacctcgcctggcacttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Fc fragment of IgG, low affinity IIIa, receptor (CD16a) - haloacid dehalogenase-like hydrolase domain containing 2 - major histocompatibility complex, class II, DR beta 5 - Fc fragment of IgG, low affinity IIIa, receptor (CD16a) |